Agrilus auroguttatus Agrilus coxalis

Improving trapping methods for buprestid beetles to enhance monitoring of native and invasive species External link

Source country academic-forestry Wednesday, February 12, 2020 11:55:00 AM CET | info [other]

Trigger words: [AgrilusCoxalisAuroguttatus-PHT] goldspotted oak borer[1]; Agrilus auroguttatus[1];

Other categories: New Plant Pests; Invasive Alien Species; Agrilus planipennis; Agrilus anxius; Multiple Species;

Abstract Most of the current understanding of the orientation and communication of jewel beetles arose from research on the Asian emerald ash borer (EAB), Agrilus planipennis , which has become one of the most destructive invasive forest insect pests in history following its introduction to North America and European Russia....

What is killing the native oaks of Southern California? External link

Source country whittierdailynews Tuesday, January 14, 2020 3:25:00 AM CET | info [other]

Trigger words: [AgrilusCoxalisAuroguttatus-PHT] Goldspotted Oak Borer[2];

Other categories: Insecticides; Multiple Species;

The Goldspotted Oak Borer, or GSOB, is an invasive beetle that is killing native oaks in several areas of Southern California. Susceptible oaks include coast live oak, canyon live oak, and California black oak. In many cases, GSOB has damaged or killed mature oaks valued for their beauty, wildlife habitat, and shade....

More articles...

Agrilus planipennis

Emerald ash borer is confirmed in Mower County External link

Source country kimt Thursday, April 2, 2020 10:15:00 PM CEST | info [other]

Trigger words: [AgrilusPlanipennis-PHT] Emerald ash borer[1]; emerald ash borer[2];

Other categories: New Plant Pests; Multiple Species;

RACINE, Minn. The emerald ash borer (EAB) has been confirmed in Mower County. A Minnesota Department of Agriculture (MDA) employee noticed several ash trees along Highway 63 north of Racine with symptoms of infestation and MDA staff were able to find live larvae of the destructive pest which has been found in 22 other counties in the state....

Agrilus planipennis, Emerald Ash Borer | opens in a new tab External link

Source country freshfromflorida Wednesday, April 1, 2020 4:16:00 AM CEST | info [other]

Trigger words: [AgrilusPlanipennis-PHT] Emerald Ash Borer[1]; Agrilus planipennis[1];

Entities: Ram Singh[1];

Other categories: New Plant Pests; Multiple Species; Additives; Feed;

Bagrada bug (Bagrada hilaris) (Hemiptera: Pentatomidae) an Exotic Pest of Cruciferae Established in the Western USA Susan Halbert, Susan.Halbert@FreshFromFlorida.com, Entomologist, Florida Department of Agriculture and Consumer Services, Division of Plant Industry Joseph E. Eger, Jeeger@Dow....

More articles...

Anastrepha ludens

USDA Begins Surveying and Trapping for Mexican Fruit Flies in Lower Rio Grande Valley, Texas External link

Source country aphis-usda Thursday, March 5, 2020 4:03:00 PM CET | info [other]

Trigger words: [AnastrephaLudens-PHT] Anastrepha ludens[1]; Mexican fruit fly[4];

Other categories: Tephritidae;

. Public can help eradicate pest. WASHINGTON, March 5, 2020 – The U.S. Department of Agriculture’s Animal and Plant Health Inspection Service (APHIS) is working with the Texas Department of Agriculture.......

Recital de percuție cu sibianul Sorin Rotaru la Sala Thalia External link

Source country jurnalul Wednesday, March 4, 2020 4:20:00 PM CET | info English text... [en] [other]

Trigger words: [AnastrephaLudens-PHT] al Ludens[1];

Entities: Dennis Kuhn[1]; Sala Thalia[2]; Peter Sadlo[1]; Keiko Abe[1]; Alexandru Matei[1];

Other categories:

Percuționistul sibian Sorin Rotaru va susține un recital vineri 6 martie 2020, la Sala Thalia, acompaniat de pianistul Iulian Ochescu - laureat al Concursului Internațional ”Piotr Ilici Ceaikovski” în anul 2019. Evenimentul, programat la ora 19, face parte din stagiunea muzicală ”Beethovenescu” și.......

Recital of percussion with sibianul Sorin Rotaru at Sala Thalia

Drummer theatre Sorin Rotaru will support a recital on Friday 6 March 2020, at Sala Thalia, accompanied by pianist Iulian Ochescu - winner of the international contest’ pyotr ilyich tchaikovsky’ in 2019. The event, scheduled at 19, part of musical season’ and’ Beethovenescu....

More articles...

Andean potato latent virus

Using high‐throughput sequencing in support of a plant health outbreak reveals novel viruses in Ullucus tuberosus (Basellaceae) External link

Source country wiley-pp Wednesday, March 6, 2019 8:26:00 AM CET | info [other]

Trigger words: [AndeanPotatoLatentVirus-PHT] Andean potato latent virus[1];

Other categories: Potato spindle tuber viroid;

Ullucus tuberosus (ulluco) is a tuber‐forming species that has become a novel crop in highland and temperate maritime climates. Eight viruses have been previously reported infecting Ullucus , including Andean potato latent virus (APLV), a quarantine virus within the European Union....

V. Harju External link

Source country wiley-pp Wednesday, March 6, 2019 8:26:00 AM CET | info [other]

Trigger words: [AndeanPotatoLatentVirus-PHT] Andean potato latent virus[1];

Other categories: Bemisia Tabaci; Tickeners;

Virus transmission studies were conducted under glasshouse conditions using the vector Bemisia tabaci biotype B to determine how effectively isolates of the begomoviruses Tomato yellow leaf curl virus (TYLCV) and Tomato leaf curl Bangalore virus (ToLCBV) could be transmitted to phaseolus bean,.......

More articles...

Andean potato mottle virus

Pest categorisation of non‐EU viruses and viroids of potato External link

Source country efsa Thursday, January 9, 2020 4:34:00 PM CET | info [other]

Trigger words: [AndeanPotatoMottleVirus-PHT] APMoV[1];

Other categories: Tomato leaf curl New Delhi virus; Potato black ringspot virus; Epidemic; EFSA; European Food Safety Authority;

Following a request from the EU Commission, the Panel on Plant Health has addressed the pest categorisation of those viruses and viroids (hereafter referred to as viruses) of Solanum tuberosum and other tuber‐forming Solanum spp. (hereafter referred to as potato) which are considered to be either.......

Genome sequence and phylogenetic analysis of a novel comovirus from tabasco pepper ( Capsicum frutescens ) External link

Source country springer-vg Friday, October 11, 2019 12:24:00 PM CEST | info [other]

Trigger words: [AndeanPotatoMottleVirus-PHT] APMoV[2]; Andean potato mottle virus[1];

Other categories:

Abstract. A virus isolate from tabasco pepper ( Capsicum frutescens ) has been reported as a strain of the comovirus Andean potato mottle virus (APMoV). Using the replicative intermediate viral dsRNA, the pepper virus strain was sequenced by Illumina MiSeq....

More articles...

AnomalaOrientalis-PHT

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Anoplophora glabripennis

USDA plans for Asian longhorned beetle eradication External link

Source country farmanddairy Thursday, April 2, 2020 7:14:00 AM CEST | info [other]

Trigger words: [AnoplophoraGlabripennis-PHT] Asian longhorned beetle[2];

Other categories: New Plant Pests; Invasive Alien Species; Insecticides; Multiple Species;

WASHINGTON — The U.S. Department of Agriculture’s Animal and Plant Health Inspection Service (APHIS) is announcing its plans for combatting the Asian longhorned beetle (ALB) in New York, Massachusetts and Ohio in 2020. Every year, APHIS evaluates and determines the most effective options to achieve ALB eradication....

Royan : le capricorne des agrumes toujours sous surveillance External link

Source country sudouest Wednesday, April 1, 2020 1:42:00 PM CEST | info English text... [en] [other]

Trigger words: [AnoplophoraGlabripennis-PHT] capricornes asiatiques[2];

Other categories:

plane sur Royan. L’an dernier, la présence de capricornes asiatiques des agrumes a été révélée dans certains secteurs de la station balnéaire. Un plan de surveillance et d’éradication est donc mis en uvre , conduit par la Direction régionale de l’alimentation, de l’agriculture et de la forêt (DRAAF)....

Royan: the serow citrus always under surveillance

Flat on Royan. Last year, the presence of asian capricornes citrus fruit has been proved in some sectors of the seaside resort. A plan for the monitoring and eradication is therefore implemented, led by the regional directorate of food, agriculture and forestry (DRAAF).

More articles...

AtropellisSpp-PHT

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Bactrocera tryoni

Odorant-Based Detection and Discrimination of Two Economic Pests in Export Apples External link

Source country bioone Monday, March 30, 2020 2:21:00 PM CEST | info [other]

Trigger words: [BactroceraTryoni-PHT] Bactrocera tryoni[1]; Queensland fruit fly[1];

Other categories: Tephritidae; Bactrocera tsuneonis; Volatile Organic Compounds emissions (VOCs);

Detection of pest infestations in fresh produce traded internationally could offer improved prospects for reducing the movement of unwanted pests. Because immature stages of some pests can be difficult to find visually, other cues such as herbivore-induced volatiles that can potentially be detected.......

Decay of Thermal Tolerance in Queensland Fruit Fly Eggs ( Bactrocera tryoni , Diptera: Tephritidae) Following Non-Lethal Heat Hardening External link

Source country bioone Monday, March 30, 2020 2:21:00 PM CEST | info [other]

Trigger words: [BactroceraTryoni-PHT] Queensland Fruit Fly[1]; Bactrocera tryoni[2]; Queensland fruit fly[1];

Other categories: Tephritidae; Bactrocera tsuneonis;

Quarantine disinfestation treatments for Queensland fruit fly ( Bactrocera tryoni (Froggatt)) have been developed which use high temperatures to kill preimaginal life stages within fruit prior to export. However, thermal tolerance of individuals can be increased if they are exposed to elevated temperatures before disinfestation treatment....

More articles...

Bursaphelenchus xylophilus

今年辽封控隔离野生动物 人工繁育场所阻断疫病传播 External link

Source country chinanews-ln Friday, April 3, 2020 5:49:00 AM CEST | info English text... [en] [other]

Trigger words: [BursaphelenchusXylophilus-PHT] 松材线虫[1];

Entities: Li Na[1];

Other categories:

本报讯 辽沈晚报记者李娜报道 2020年,辽宁计划人工造林130万亩、封山育林83万亩,完成育苗25万亩、12亿株,启动1000个村庄绿化工作。同时,加强野生动植物保护管理,封控隔离野生动物人工繁育场所,禁止野生动物非法交易,阻断野生动物疫病可能向人类传播的途径。 日前,辽宁省林业和草原工作会议在沈阳市召开,会议明确了2020年重点工作。2020年,辽宁林草部门将坚决打好野生动物管控、森林草原防灭火和松材线虫病除治三项攻坚战。全面加强林草行业负责的林地、草地、湿地、沙地四大工作领域的各项生态保护和建设工作。确保在“十三五”期末实现全省森林覆盖率42%,森林总蓄积量不低于3.41亿立方米,国家级公益林保有量3600万亩,湿地保有量2092....

Last at least control package isolation wildlife artificial breeding places epidemics have spread blocking

The reported The Liaoshen Evening News reporter Li Na reported in 2020, Liaoning reforestation program 130 million mu of 83 million mu, closing hillsides to complete the nursery 25 million mu, 12 million trees and start the 1000 Village Green. At the same time, strengthen the protection of wild fauna and flora, package management controls isolation wildlife artificial breeding places, against the illicit trade in wildlife, blocking wildlife diseases might be submitted to the dissemination of human beings. Recently, Liaoning Provincial forestry and grassland work conference held in the Shenyang City, the meeting clearly focused on the work of the year 2020. In 2020, Liaoning forest sector will resolutely win wildlife control, forest and grassland fire prevention and pine disease in addition to the analysis of the three tough battle. Comprehensive strengthening grass industry is responsible for the forest and grassland, wetlands, Saudi Arabia four major areas of work of the ecological protection and construction work. Make sure that the "十三五" in the province toward the end of the forest cover 42 per cent of total forest, the mandatory provident fund schemes is not less than 3.41 billion cubic meters, national-level public Bowie Lam over 3600 million mu, wetland tenure 2092. volume

Echanges mondiaux et santé des plantes : stratégies... External link

Source country phytoma-ldv Friday, April 3, 2020 4:32:00 AM CEST | info English text... [en] [other]

Trigger words: [BursaphelenchusXylophilus-PHT] Bursaphelenchus xylophilus[1];

Other categories: Xylella fastidiosa; Rhynchophorus ferrugineus;

Les organismes nuisibles n’ont pas de frontières. En santé végétale, comme en santé humaine, la mondialisation implique de coordonner les efforts, en commençant par la prévention. Le14 décembre dernier est entré en application un nouveau règlement (UE 2016/2031) relatif à la santé des végétaux) avec.......

Global trade and health of plants: strategies...

Harmful organisms have no borders. Plant health, as human health, globalisation entails coordinate efforts, starting with prevention. Le14 last December entered under a new regulation (EU 2016/2031) on plant health) with....

More articles...

Ceratocystis fagacearum

Cautious road crews gearing up for spring construction season amid coronavirus pandemic External link

Source country freep Wednesday, April 1, 2020 2:25:00 PM CEST | info [other]

Trigger words: [CeratocystisFagacearum-PHT] oak wilt[1];

Entities: Gretchen Whitmer[1]; Craig Bryson[1]; Mike Nystrom[1];

Other categories: New Plant Pests; Coronavirus Infection;

Quotes... Quotes in this article

Mike Nystrom said: “It doesn’t seem like all construction work is essential,”

Craig Bryson said: “Certainly the health and safety of every person working on our projects is our top priority. But we think they can continue practicing social distancing and there typically is little or no interaction with the public on these projects,”

The orange construction barrels are starting to appear on local and state roadways, but the traffic jams are not. The coronavirus pandemic hasn’t stopped some road projects from moving forward although construction season won’t get fully underway until later in April. With stay-at-home orders from Gov....

Home and yard improvement: Do it yourself or hire? External link

Source country jsonline Thursday, March 19, 2020 12:19:00 PM CET | info [other]

Trigger words: [CeratocystisFagacearum-PHT] oak wilt[1];

Other categories:

No matter if it’s a minor trendy tweak or a major knockdown overhaul in home improvement, who does the work usually boils down to a matter of time, money, expectations and safety. In spring, there are plenty of enhancement possibilities inside and out....

More articles...

Cowpea mild mottle virus

Detection of Cowpea mild mottle virus (Carlavirus) in Queensland External link

Source country ippc Wednesday, February 12, 2020 5:36:00 AM CET | info [other]

Trigger words: [CowpeaMildMottleVirus-PHT] Cowpea mild mottle virus[4];

Other categories: Bemisia Tabaci;

Common bean (Phaseolus vulgaris), peanut (Arachis hypogaea), tomato (Solanum lycopersicum), chia (Salvia hispanica), cowpea (Vigna unguiculata) and soybean (Glycine max). Fassifern and Lockyer Valley, Queensland; Cowpea mild mottle virus is known to cause severe distortion, twisting and.......

The plant defence inducer activity of Anacardium occidentale Linn., Azadiracta indica A. Juss. and Zingiber officinale Rosc. extracts against Cowpea m External link

Source country apc Thursday, November 21, 2019 9:21:00 AM CET | info [other]

Trigger words: [CowpeaMildMottleVirus-PHT] Cowpea mild mottle virus[2];

Other categories: Bemisia Tabaci; Antiviral; Insecticides; Environment;

At present, control of Cowpea mild mottle virus (CPMMV) and its vector is based on the use of insecticide. In recent decades, this method have a negative impact to the environment. Consequently, it is important to search the alternative control against CPMMV infecting soybean The aim of this study.......

More articles...

Cryphonectria Parasitica

Next-generation GMO crops poised to make major contributions to sustainable farming and medicine External link

Source country geneticliteracyproject Friday, March 27, 2020 12:09:00 PM CET | info [other]

Trigger words: [CryphonectriaParasitica-PHT] chestnut blight[1];

Other categories: Pharmaceuticals; Multiple Species; GM Animals;

. Golden Potatoes: Vitamin-A fortified GMO variety could help tackle childhood blindness in Africa. This article or excerpt is included in the GLP’s daily curated selection of ideologically diverse news, opinion and analysis of biotechnology innovation. have been planted in different countries for over twenty years, starting from 1996....

Biotech Crops in the Pipeline to Improve Food Quality and Bring Environmental Benefits External link

Source country isaaa Wednesday, March 25, 2020 10:14:00 AM CET | info [other]

Trigger words: [CryphonectriaParasitica-PHT] chestnut blight[1];

Other categories: Pharmaceuticals; Multiple Species; GM Animals;

have been planted in different countries for over twenty years, starting from 1996. About 191.7 million hectares were planted in 2018 to transgenic crops with high market value, such as , and canola ; insect resistant maize, cotton, potato, and rice ; and virus resistant squash and papaya....

More articles...

Diabrotica virgifera

Fermierii din Moldova au aflat noutăţile la cultura de porumb External link

Source country lumeasatului Thursday, April 2, 2020 9:29:00 AM CEST | info English text... [en] [other]

Trigger words: [DiabroticaVirgifera-PHT] Diabrotica virgifera virgifera[1]; Diabrotica virgifera[1];

Entities: Mării Negre[1];

Other categories: Insecticides; Fusarium; Fungi;

Asociaţia Producătorilor de Porumb din România (APPR) şi Asociaţia Cultivatorilor de Cereale şi Plante Tehnice (ACCPT) Iaşi au organizat luna trecută, la Iași, Conferinţa Tehnică APPR- Porumbul Românesc în 2020 – Expertiza Tehnică şi Provocări Economice....

Farmers of Moldova were novelties to maize crop

Maize producers association in romania (APPR) and the growers of cereals and industrial crops (ACCPT) iasi held last month, in Iași, romania APPR - maize technical conference in 2020 – technical expertise and economic challenges.

Fumigant toxicity of essential oil of Hypericum perforatum L., 1753 (Malpighiales: Hypericaceae) to Tenebrio molitor L., 1758 (Coleoptera: Tenebrionid External link

Source country dergipark Monday, March 30, 2020 6:22:00 PM CEST | info [other]

References. Abbott, W., 1925. A method for computing the effectiveness of an insecticide. Journal of Economic Entomology, 18: 265-267. Aebi, H., 1984. Catalase in vitro. Methods in Enzymology, 105: 121-126. Aslanturk, A., S. Kalender, M. Uzunhisarcikli & Y. Kalender, 2011....

More articles...

Diaporthe spp

JoF, Vol. 4, Pages 65: Antifungal Activities of Volatile Secondary Metabolites of Four Diaporthe Strains Isolated from Catharanthus roseus External link

Source country mdpi Wednesday, May 30, 2018 12:10:00 PM CEST | info [other]

Trigger words: [DiaportheSpp-PHT] Diaporthe[7];

Other categories: Volatile Organic Compounds emissions (VOCs); Alternaria alternata; Alternaria; Fusarium;

Abstract Four endophytic fungi were isolated from the medicinal plant, Catharanthus roseus , and were identified as Diaporthe spp. with partial translation elongation factor 1-alpha ( TEF1 ), beta-tubulin ( TUB ), histone H3 ( HIS ), calmodulin ( CAL ) genes, and rDNA internal transcribed spacer.......

More articles...

Diplocarpon mali

A genome-wide association study for the detection of genes related to apple Marssonina Blotch disease resistance in apples External link

Source country sciencedirect Tuesday, December 10, 2019 7:13:00 AM CET | info [other]

Trigger words: [DiplocarponMali-PHT] Diplocarpon mali[1];

Other categories: Phyllosticta solitaria;

Apple Marssonina Blotch (AMB), commonly referred to as apple blotch disease, is caused by Diplocarpon mali and represents one of the major diseases in Korean apple orchards. AMB can occur on the leaves and fruit, which lowers fruit quality and leads to early defoliation, reducing tree vigor and growth....

MBCAST: A Forecast Model for Marssonina Blotch of Apple in Korea External link

Source country ppjonline Thursday, December 5, 2019 2:48:00 AM CET | info [other]

Trigger words: [DiplocarponMali-PHT] Marssonina Blotch of Apple[1]; Marssonina blotch of apple[1];

Other categories: Phyllosticta solitaria;

A disease forecast model for Marssonina blotch of apple was developed based on field observations on airborne spore catches, weather conditions, and disease incidence in 2013 and 2015. The model consisted of the airborne spore model (ASM) and the daily infection rate model (IRM)....

More articles...

Ditylenchus destructor

First report of Bursaphelenchus fungivorus (Nematoda: Aphelenchida) in Italy and an overview of nematodes associated with Crocus sativus L. External link

Source country exeley Monday, March 30, 2020 11:42:00 AM CEST | info [other]

Trigger words: [DitylenchusDestructor-PHT] Ditylenchus destructor[1];

Other categories:

Collecting corms and nematodes extraction. In September 2018, 20 corms of Crocus sativus were collected by the Plant Protection Service of Lazio Region on the farm “Arte Zafferano” located in Terracina (Latina, Lazio, Central Italy), in the karst area of Campo Soriano....

Potato Rot Nematode (Ditylenchus destructor) confirmed in Ontario, Canada External link

Source country ippc Wednesday, February 12, 2020 5:36:00 AM CET | info [other]

Trigger words: [DitylenchusDestructor-PHT] Potato Rot Nematode[1]; Ditylenchus destructor[2];

Other categories:

Publication Date: Thu, 01 Sep 2011, 02:00; Last Updated: Aug. 31, 2011, 11:01 a.m. Report Number: CAN-10/2; Country: Canada; Pest Id: Ditylenchus destructor - (DITYDE) Report Status: Final; Website: .......

More articles...

Drosophila Suzukii

Kerik D. Cox External link

Source country wiley-eeapplicata Wednesday, May 29, 2019 6:32:00 AM CEST | info [other]

Trigger words: [DrosophilsSuzukii-PHT] Drosophila[1]; Drosophila suzukii[1];

Other categories: Volatile Organic Compounds emissions (VOCs); Monilinia fructicola; Pesticides; Fungicides; Multiple Species;

BACKGROUND: Quinone outside inhibitor (QoI) resistance as a consequence of point mutations in the cytochrome b cyt b ) gene has been reported in numerous plant pathogenic fungi. To examine the potential for QoI resistance development in those Monilinia species causing brown rot of stone and pome fruits [ Monilinia fructicola (G Winter) Honey, M....

Ciliegie, un disastro a Verona. Danni fino al 70 per cento per il maltempo External link

Source country corrieredelveneto Tuesday, May 28, 2019 4:56:00 PM CEST | info English text... [en] [other]

Trigger words: [DrosophilsSuzukii-PHT] Drosophila Suzukii[1]; Drosophila[1];

Entities: Edoardo Ferrara[1];

Other categories: Halyomorpha halys;

VERONA Il perdurare a maggio di temperature autunnali sta influendo negativamente anche sulla stagione delle ciliegie. Freddo e pioggia hanno provocato quello che nel settore viene definito cracking ovvero la spaccatura delle varietà precoci, causando ingenti perdite economiche....

Cherries, a disaster to Vérone. Damage up to 70 per cent for the bad weather

In may the ongoing Vérone _c is autumn season negatively influence the cherries. Cold and rain have resulted in what is called the split or cracked early varieties, causing huge economic losses.

More articles...

Eotetranychus lewisi

Nowe zagrożenia fitosanitarne dla Polski External link

Source country farmer Thursday, August 23, 2018 9:50:00 AM CEST | info English text... [en] [other]

Trigger words: [EotetranychusLewisi-PHT] Eotetranychus lewisi[1];

Other categories: Potato leafroll virus; Virus; Andean potato mottle virus; Andean potato latent virus; Fusarium; Natural Carotenoid Dye; Fungi;

Jednym z zagrożeń są wirusy stwierdzone w ziemniakach z Peru przewożonych w bagażu pasażera, podróżującego do Holandii. - W bagażach pasażerów podróżujących po całym świecie może niestety znajdować się różnorodny materiał roślinny, pomimo, że jest to ograniczone do niewielkich ilości określonego.......

New threats phyto-sanitary measures for poland

One danger are viruses found in potatoes from Peru goods contained in the luggage of a passenger travelling to the netherlands. - in the luggage of passengers around the world can, unfortunately, be diverse plant material, although this is limited to small quantities referred to....

More articles...

Erwinia Amylovora

Crop Insurance and the COVID-19 Virus External link

Source country psu Thursday, April 2, 2020 3:09:00 PM CEST | info [other]

Trigger words: [ErwiniaAmylovora-PHT] Fireblight[1];

Other categories: Coronavirus Infection;

COVID-19 Virus Changes. Due to the COVID-19 virus, the Governor of Pennsylvania (PA) has issued Stay-at-home orders for many counties in PA. These orders may affect a producer’s ability to submit some of the necessary documentation needed for crop insurance....

Nordox 75 WG External link

Source country agroklub Wednesday, April 1, 2020 8:56:00 PM CEST | info English text... [en] [other]

Trigger words: [ErwiniaAmylovora-PHT] Erwinia amylovora[1];

Other categories: Phytophthora infestans; Fungicides; Alternaria; Phomopsis; Fungi;

Opis pripravka: Nordox 75 WG je površinski fungicid širokog spektra djelovanja na bazi bakra iz bakrenog oksida. Suzbija široki spektar gljivičnih bolesti. Koristi se također protiv bakterijskih bolesti na raznom bilju. Formulacija omogućava visoku selektivnost i poboljšanu mogućnost miješanja u odnosu na bordošku juhu....

Nordox 75 WEGENER

Description of the preparation: Nordox 75 Wegener's superficial fungicide broad spectrum of activity on the basis of copper from copper oxide. It quenches the wide spectrum of fungal diseases. It's also against bacterial disease in a variety of herbs and spices. Formulation provides high selectivity and improved the possibility of involvement in relation to the bordošku soup.

More articles...

Euphorbia mosaic virus

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Flavescence dorée

OLTREPÒ PAVESE - MALATTIE LEGNO MINACCIANO 10% VITI IN ITALIA External link

Source country ilperiodiconews Thursday, April 2, 2020 6:55:00 PM CEST | info English text... [en] [other]

Trigger words: [FlavescenceDoree-PHT] flavescenza dorata[1];

Other categories: Food Contact Material;

Il mal d'esca e la flavescenza dorata insidiano il 10% dei vigneti italiani, ma si prevengono e combattono con potatura e scelte agronomiche corrette. E' il messaggio che arriva dal convegno 'Non abbocchiamo all'esca' organizzato a Novi Ligure (Alessandria) dal Consorzio di Tutela del Gavi....

Oltrepò PAVESE - diseases wood threaten 10% screws IN Italy

The badly of bait and undermine as 10% of vineyards in Italy, but that preventing and fighting with pruning correct agronomic and choices. This is the message being sent out by the conference is not in bait abbocchiamo 'organised in Novi Ligure (alexandria) by the consortium of protection of Gavi.

Spostamenti vietati per gli agricoltori, appello ai sindaci External link

Source country ilgolfo24-it Thursday, April 2, 2020 5:27:00 PM CEST | info English text... [en] [other]

Trigger words: [FlavescenceDoree-PHT] flavescenza dorata[2];

Other categories: Coronavirus Infection;

Una richiesta che risponde a dei criteri sacrosanti, a cui le autorità competenti dovrebbero dare una risposta. Perché tra le tante limitazioni che circolano in tempo di Coronavirus, questa è davvero la più assurda ed ingiustificabile. Esiste un vulnus e questo va colmato a tutti i costi....

Movements prohibited for farmers, appeal to mayors

In response to a request of the sacrosanct criteria, to which the competent authorities should respond. Because of the many restrictions which move in time of Coronavirus, is this really the most ridiculous and unjustifiable. There is a crack and that cannot be bridged at all costs.

More articles...

Geosmithia morbida

Bagno detox: crea una spa a casa tua External link

Source country trevisotoday Thursday, April 2, 2020 7:51:00 PM CEST | info English text... [en] [other]

Trigger words: [GeosmithiaMorbida-PHT] giovane, morbida[1];

Other categories: Sodium;

In questo periodo i livelli di stress e tensioni che si traducono in rigidità muscolare, sono divenuti routine. Ritaglia del tempo per te stessa/o e immergiti in un bagno di relax. Fare un bagno caldo, induce un senso di calma e in questo momento, ricercare e curarsi dedicandosi un momento di coccole, è doveroso....

Detox bath: creates a spa at home your

During this period the levels of stress and tension which translates into muscular stiffness, have become routine. Ritaglia time about people and/or immergiti into a bath of relaxation. Take a warm bath, a sense of calm and now seek treatment and a moment of dedicandosi coccole, is essential.

Host selection behavior mediated by differential landing rates of the walnut twig beetle, Pityophthorus juglandis, and associated subcortical insect s External link

Source country wiley-eeapplicata Saturday, March 21, 2020 11:22:00 AM CET | info [other]

Trigger words: [GeosmithiaMorbida-PHT] Geosmithia morbida[1]; thousand cankers disease[1];

Other categories: Pityophthorus juglandis; Multiple Species; Food Contact Material;

The walnut twig beetle, Pityophthorus juglandis Blackman (Coleoptera: Scolytidae), vectors a phytopathogenic fungus, Geosmithia morbida Kolařík et al. (Hypocreales), which causes thousand cankers disease (TCD) in walnut ( Juglans sp.) and wingnut ( Pterocarya sp., both Juglandaceae) trees....

More articles...

Halyomorpha halys

«Raccolta impossibile E dopo gelate e cimice restano nei campi fragole e asparagi» External link

Source country mattinopadova Friday, April 3, 2020 4:25:00 AM CEST | info English text... [en] [other]

Trigger words: [HalyomorphaHalys-PHT] cimice asiatica[1];

Entities: Maurizio Antonini[1];

Other categories: Coronavirus Infection;

L’agricoltura padovana messo in ginocchio dall’emergenza Coronavirus. Non solo non si riescono a reperire prodotti specifici per la lavorazione dei campi, ma non si trova nemmeno la manodopera. Molti temono il contagio e non se la sentono di rischiare andando a lavorare nei campi o negli.......

'Collection impossible and after frost and cimice remain in camps strawberries and asparagus’

L'agricoltura padovana crippled dall'emergenza Coronavirus. Not only do not manage to find specific products for working in the fields, but there is not even the workforce. Many fear contagion and not have it in them moving out of their fields or....

News in Rimini External link

Source country corriereromagna Friday, April 3, 2020 1:01:00 AM CEST | info English text... [en] [other]

Trigger words: [HalyomorphaHalys-PHT] cimice asiatica[2];

Entities: Raffaella Sensoli[1]; Giorgio Pruccoli[1]; Andrea Corsini[1];

Other categories: Coronavirus Infection;

Raffaella Sensoli entra nella segreteria dell’assessore regionale al turismo Andrea Corsini e nel Pd non tutti esultano. Tutt’altro. Giorgio Pruccoli lascia il partito. Tecnicamente è successo questo. Alcuni giorni fa… Uscire per una breve passeggiata con i bimbi si potrà....

News in rimini

Raffaella Sensoli enters the secretariat dell'assessore regional tourism Andrea Corsini and Pd not all are celebrating. Far from it. Giorgio Pruccoli leaves the party. This happened kraftnät. A few days fa… Leave for a short walk with children can be.

More articles...

Heterobasidion irregulare

Monitoring the control methods of Heterobasidion annosum s.l. root rot External link

Source country avhandlingar Tuesday, March 31, 2020 11:54:00 PM CEST | info [other]

Trigger words: [HeterobasidionIrregulare-PHT] Heterobasidion annosum[2];

Other categories:

Sök bland 90751 doktorsavhandlingar från svenska högskolor och universitet! Monitoring the control methods of Heterobasidion annosum s.l. root rot. Denna avhandling är EVENTUELLT nedladdningsbar som PDF....

Jaana Jurvansuu External link

Source country microbiologyresearch-jgv Monday, March 30, 2020 6:43:00 PM CEST | info [other]

Trigger words: [HeterobasidionIrregulare-PHT] Heterobasidion annosum[1];

Other categories:

The Argentine ant ( Linepithema humile Mayr) is a highly invasive species. Recently several RNA viruses have been identified in samples from invasive Argentine ant colonies. Using quantitative PCR we investigated variation in the levels of these viruses in the main European supercolony over the course of a year....

More articles...

HymenoscyphusPseudoalbidus-PHT

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Lettuce infectious yellows virus

Nonstructural p26 proteins encoded by the 3’-proximal genes of velariviruses and criniviruses are orthologs External link

Source country springer-av Friday, January 31, 2020 8:24:00 AM CET | info [other]

Trigger words: [LettuceInfectiousYellowsVirus-PHT] LIYV[1]; lettuce infectious yellows virus[1];

Other categories: Bemisia Tabaci;

Fig. 2. Multiple alignment and predicted secondary structure of the p26 proteins of representatives of the genera Crinivirus and Velarivirus . Predicted alpha-helices (H) and beta-strands (B) are indicated. Criniviruses: PYVV (potato yellow vein virus, YP_054414.1), TVCV (tetterwort vein chlorosis virus, ALE18225....

Nonstructural p26 proteins encoded by the 3’-proximal genes of velariviruses and criniviruses are orthologs External link

Source country springer-av Wednesday, December 11, 2019 7:43:00 AM CET | info [other]

Trigger words: [LettuceInfectiousYellowsVirus-PHT] LIYV[1]; lettuce infectious yellows virus[1];

Other categories: Bemisia Tabaci;

Fig. 2. Multiple alignment and predicted secondary structure of the p26 proteins of representatives of the genera Crinivirus and Velarivirus . Predicted alpha-helices (H) and beta-strands (B) are indicated. Criniviruses: PYVV (potato yellow vein virus, YP_054414.1), TVCV (tetterwort vein chlorosis virus, ALE18225....

More articles...

Monilinia fructicola

Ting Zhou External link

Source country hortsci Friday, April 3, 2020 4:52:00 AM CEST | info [other]

Trigger words: [MoniliniaFructicola-PHT] Monilinia fructicola[1];

Other categories: Potato leafroll virus; Methyl; Pesticides; Fungicides; Nitrates; Additives; Food Contact Material; Preservatives;

The banning of synthetic fungicides for postharvest use on fruits in Canada has prompted a search for alternative control strategies for postharvest brown rot caused by Monilinia fructicola (Wint.) Honey on sweet cherry ( Prunus avium L.). Thymol and carvacrol were the two most potent fungicides among the monoterpenoids tested....

Heping Zhu External link

Source country horttech Thursday, April 2, 2020 5:13:00 AM CEST | info [other]

Trigger words: [MoniliniaFructicola-PHT] Monilinia fructicola[1];

Other categories: Diaporthe vaccinii; Pesticides; Elsinoe spp.; Multiple Species; Phomopsis; Fungi;

Spray deposition and coverage at different application rates for nursery liners of different sizes were investigated to determine the optimal spray application rates. Experiments were conducted on 2- and 3-year-old ‘Autumn Spire’ red maple ( Acer rubrum ) liners....

More articles...

Nacobbus aberrans

Energía solar para mejorar la salud de los suelos External link

Source country on24 Saturday, March 14, 2020 3:42:00 PM CET | info English text... [en] [other]

Trigger words: [NacobbusAberrans-PHT] Nacobbus aberrans[1];

Other categories: food security; Pesticides; Fusarium; Fungi;

En los últimos años, investigadores de todo el mundo concentran sus esfuerzos en desarrollar técnicas no contaminantes para la desinfección del suelo. En este sentido, especialistas del INTA San Pedro –Buenos Aires– trabajan en la aplicación de la solarización combinada con biofumigación para el.......

Solar energy to improve the health of the soil

In recent years, researchers around the world are concentrating their efforts on developing zero-emission techniques for the soil disinfection. In this sense, specialists in the INTA San Pedro –buenos Aires– work in the implementation of the solarización combined with biofumigación for the....

Energía solar para mejorar la salud de los suelos External link

Source country on24 Wednesday, February 5, 2020 9:27:00 PM CET | info English text... [en] [other]

Trigger words: [NacobbusAberrans-PHT] Nacobbus aberrans[1];

Other categories: food security; Pesticides; Fusarium; Fungi;

En los últimos años, investigadores de todo el mundo concentran sus esfuerzos en desarrollar técnicas no contaminantes para la desinfección del suelo. En este sentido, especialistas del INTA San Pedro –Buenos Aires– trabajan en la aplicación de la solarización combinada con biofumigación para el.......

Solar energy to improve the health of the soil

In recent years, researchers around the world are concentrating their efforts on developing zero-emission techniques for the soil disinfection. In this sense, specialists in the INTA San Pedro –buenos Aires– work in the implementation of the solarización combined with biofumigación for the....

More articles...

Ophiostoma novo-ulmi

New Tree Selection Guide Available From TreeVitalize External link

Source country psu Wednesday, March 25, 2020 7:20:00 PM CET | info [other]

Trigger words: [OphiostomaNovoulmi-PHT] Dutch Elm Disease[1];

Other categories: Agrilus planipennis; Multiple Species;

As an Extension Urban Forester, we are often asked by shade tree commissions or homeowners to provide a short list of the “best” trees to plant along streets and homes. I know I have my favorites, but if we just told communities to plant x, y or z species of tree, we would continue with the promote.......

Bionomics of Scolytus schevyrewi (Coleoptera: Curculionidae) in Saskatchewan and Manitoba, Canada External link

Source country cambridge-entomologist Wednesday, March 25, 2020 11:47:00 AM CET | info [other]

Trigger words: [OphiostomaNovoulmi-PHT] Dutch elm disease[3]; Ophiostoma novo-ulmi[2];

Other categories: New Plant Pests; Emerging disease;

The invasive alien Scolytus schevyrewi Semenov (Coleoptera: Curculionidae: Scolytinae) was detected in Saskatchewan and Manitoba, Canada, in 2007. Because S. schevyrewi is a potential vector of the Dutch elm disease pathogen ( Ophiostoma novo-ulmi Brasier; Fungi: Ophiostomataceae), the natural.......

More articles...

Peach rosette mosaic virus

PMRv inicia nesta sexta a Operação Alegria 2020 nas estradas catarinenses External link

Source country g1-globo Friday, February 21, 2020 9:17:00 PM CET | info English text... [en] [other]

Trigger words: [PeachRosetteMosaicVirus-PHT] PRMv[1];

Other categories:

A fiscalização será intensificada, com uso de radares de velocidade e bafômetros, e barreiras policiais, visando principalmente o combate ao porte ilegal de armas, tráfico de drogas e embriaguez ao volante. Na operação estarão envolvidos os 24 postos rodoviários do Comando de Policiamento.......

Operation begins in sixth PMRv joy 2020 catarinenses roads

The monitoring will be intensified, with the use of radar speed and bafômetros and barriers, aiming primarily for combating the carrying illegal arms and drugs and drunkenness at the wheel. In the operation will be involved 24 posts road control policing....

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “ Satsumavirus ”, “ Stramovirus ” and “ Cholivirus ”, in the genus Sad External link

Source country springer-av Friday, January 31, 2020 8:24:00 AM CET | info [other]

Trigger words: [PeachRosetteMosaicVirus-PHT] peach rosette mosaic virus[1]; PRMV[1];

Other categories: Satsuma dwarf virus; Arracacha virus B, oca strain; Tomato ringspot virus; Cherry rasp leaf virus; Potato black ringspot virus; Tobacco ringspot virus; Enterovirus; Viruses;

Fig. 1. Maximum-likelihood phylogenetic analysis of the Pro-Pol amino acid sequence of type isolates from recognized species in the family Secoviridae . The alignment was generated using ClustalW in MEGA X, the tree was also built in MEGA X. Bootstrap values for each node are shown (1000 replicates)....

More articles...

Pepper mild tigre virus

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Phyllosticta citricarpa

Web report of the 10th Meeting of the Panel on Diagnostics and Quality Assurance (Ljubljana, SI, 2020-02-18/20) External link

Source country eppo Friday, April 3, 2020 4:59:00 AM CEST | info [other]

Trigger words: [PhyllostictaCitricarpa-PHT] Phyllosticta citricarpa[1];

Other categories: Ralstonia solanacearum;

10 th Meeting of the Panel on Diagnostics and Quality Assurance Ljubljana (SI), 2020-02-18/20. The Panel on Diagnostics and Quality Assurance was hosted in Ljubljana (SI), at the kind invitation of the National Institute of Biology (NIB). The EPPO Secretariat was pleased to welcome new experts from Italy and Lithuania....

PPECB proves its worth External link

Source country fruitnet Friday, March 27, 2020 5:50:00 PM CET | info [other]

Trigger words: [PhyllostictaCitricarpa-PHT] citrus black spot[1];

Other categories: Coronavirus Infection; Multiple Species; Other Zoonoses;

F or more than 90 years South Africa’s PPECB has served the South African fresh produce industry with distinction. Amidst the challenges presented by the Covid-19 pandemic, the organisation is once again proving to be a vital link in keeping exports going....

More articles...

Phytophthora infestans

Amoeba : Biocontrol development partnership in France and Europe between Amoéba, PHILAGRO France and NICHINO Europe External link

Source country 4-traders Thursday, April 2, 2020 11:31:00 PM CEST | info [other]

Trigger words: [PhytophthoraInfestans-PHT] potatoes[1]; late blight[1];

Other categories: Biocides;

PRESS RELEASE. Biocontrol development partnership in France and Europe between. AMOEBA, PHILAGRO France and NICHINO Europe. Saint Didier au Mont d'Or, April 2d, 2020. PHILAGRO France NICHINO Europe and AMOEBA have signed a development contract (MTA: Material Transfer Agreement) to evaluate the.......

High-Quality Genome Assembly of Peronospora destructor, the Causal Agent of Onion Downy Mildew External link

Source country apsjournals-mpmi Thursday, April 2, 2020 9:09:00 AM CEST | info [other]

Trigger words: [PhytophthoraInfestans-PHT] Peronospora[6]; potato[1]; tomato[1];

Other categories: FAO; GMOs in Environment; GMOs in food & feed; Environment; Food Contact Material;

Peronospora destructor is an obligate biotrophic oomycete that causes downy mildew on onion ( Allium cepa ). Onion is an important crop worldwide, but its production is affected by this pathogen. We sequenced the genome of P. destructor using the PacBio sequencing platform, and de novo assembly resulted in 74 contigs with a total contig size of 29....

More articles...

Phytophthora ramorum

Sudden Oak Death, Phytopthora Ramorum, (SOD) External link

Source country freshfromflorida Wednesday, April 1, 2020 4:16:00 AM CEST | info [other]

Trigger words: [PhytophthoraRamorum-PHT] P. ramorum[1]; Phytophthora ramorum[3]; Sudden Oak Death[3]; Phytopthora Ramorum[1];

Entities: Adam H Putnam[1];

Other categories: Toxic; Equidae; Environment;

Sudden Oak Death Update, Phytophthora ramorum Dr. Tim Schubert,Timothy.Shubert@FreshFromFlorida.com, Florida Department of Agriculture & Consumer Services, Division of Plant Industry INTRODUCTION: In March 2004, CDFA and USDA announced that Sudden Oak Death (SOD) had been detected in several large.......

Sudden Oak Death External link

Source country freshfromflorida Saturday, March 21, 2020 4:52:00 AM CET | info [other]

Trigger words: [PhytophthoraRamorum-PHT] Sudden Oak Death[2];

Other categories: New Plant Pests;

All Florida Department of Agriculture and Consumer Services offices will be closed to the public until April 19. The Department is working in collaboration with other state and local officials to ensure the safety of our employees and community. We will update the public with further information as it becomes available....

More articles...

Pomacea spp.

Apple snail egg perivitellin coloration, as a taxonomic character for invasive Pomacea maculata and P. canaliculata, determined by a simple method External link

Source country springer-bi Friday, April 3, 2020 1:40:00 AM CEST | info [other]

Trigger words: [Pomacea-PHT] Pomacea[6]; Pomacea maculata[1]; P. canaliculata[1]; Apple snail[1]; P. maculata[1]; Pomacea canaliculata[1];

Other categories: Invasive Alien Species;

Abstract. Pomacea canaliculata and P. maculata are freshwater apple snails considered two of the most invasive alien species worldwide. They are expanding their ranges in Asia, Europe and North America, damaging crops, wetland ecosystems and endangering human health....

Carlo Palermo: ''Da Ilaria Alpi alle stragi, una visione di insieme sui segreti di Stato'' External link

Source country antimafiaduemila Wednesday, March 25, 2020 6:32:00 PM CET | info English text... [en] [other]

Intervista al legale della famiglia Alpi sui 26 anni di misteri di Aaron Pettinari In queste settimane, se non fosse scoppiata l'emergenza sanitaria internazionale sul Coronavirus che ha portato a ridurre anche le attività della macchina giustizia, era prevista la scadenza dei termini per le.......

Carlo Palermo: 'from Ilaria Alpi to massacres, a vision of together on state secrets'

Interview with the lawyer of the family alps on 26 years of mystery Aaron Pettinari In recent weeks, but the international health l'emergenza sars Coronavirus which led to curb the activities of the machinery, was scheduled for the end of the period.

More articles...

Potato black ringspot virus

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “ Satsumavirus ”, “ Stramovirus ” and “ Cholivirus ”, in the genus Sad External link

Source country springer-av Friday, January 31, 2020 8:24:00 AM CET | info [other]

Trigger words: [PotatoBlackRingspotVirus-PHT] potato black ringspot virus[1]; PBRSV[1];

Other categories: Satsuma dwarf virus; Arracacha virus B, oca strain; Peach rosette mosaic virus; Tomato ringspot virus; Cherry rasp leaf virus; Tobacco ringspot virus; Enterovirus; Viruses;

Fig. 1. Maximum-likelihood phylogenetic analysis of the Pro-Pol amino acid sequence of type isolates from recognized species in the family Secoviridae . The alignment was generated using ClustalW in MEGA X, the tree was also built in MEGA X. Bootstrap values for each node are shown (1000 replicates)....

Pest categorisation of non‐EU viruses and viroids of potato External link

Source country efsa Thursday, January 9, 2020 4:34:00 PM CET | info [other]

Trigger words: [PotatoBlackRingspotVirus-PHT] PBRSV[1];

Other categories: Andean potato mottle virus; Tomato leaf curl New Delhi virus; Epidemic; EFSA; European Food Safety Authority;

Following a request from the EU Commission, the Panel on Plant Health has addressed the pest categorisation of those viruses and viroids (hereafter referred to as viruses) of Solanum tuberosum and other tuber‐forming Solanum spp. (hereafter referred to as potato) which are considered to be either.......

More articles...

Potato spindle tuber viroid

Web report of the 26th Meeting of the Panel on Phytosanitary Measures for Potato (Santa Cruz de Tenerife, ES, 2020-02-11/13) External link

Source country eppo Thursday, April 2, 2020 4:24:00 AM CEST | info [other]

Trigger words: [PotatoSpindleTuberViroid-PHT] PSTVd[1];

Other categories: Clavibacter michiganensis ssp. sepedonicus; Globodera rostochiensis; Ralstonia solanacearum; Globodera pallida;

26 th Meeting of the Panel on Phytosanitary Measures for Potato Santa Cruz de Tenerife, ES, 2020-02-11/13. The 26 th meeting of the Panel on Phytosanitary Measures for Potato took place in Santa Cruz de Tenerife (ES) on 2020-02-11/13. The Panel discussed Standards under revision or development. Standards under revision....

Update from the CPM Bureau: May 2013 External link

Source country ippc Wednesday, April 1, 2020 5:29:00 AM CEST | info [other]

Trigger words: [PotatoSpindleTuberViroid-PHT] Potato spindle tuber viroid[1];

Other categories: Xanthomonas citri pv. citri; Tephritidae; FAO;

Dear colleagues It was good to see many of you at the CPM meeting in April. I hope you took the opportunity to get to know your regional Bureau member and to attend the side sessions, as well as having some time to enjoy Rome. This note is to provide some updates on current issues and to provide some reminders of actions you need to take....

More articles...

Potato virus T

Complete genome sequence of rose virus A, the first carlavirus identified in rose External link

Source country springer-av Saturday, January 11, 2020 10:35:00 AM CET | info [other]

Trigger words: [PotatoVirusT-PHT] potato virus T[1];

Other categories: Swine Flu; Potato leafroll virus;

Phylogenetic relationships of rose virus A (RVA) to recognized members of the family Betaflexiviridae . The viruses used in the analyses and their abbreviations and GenBank accession numbers are as follows: poplar mosaic virus (PopMV), AY505475; elderberry virus A (ElVA), KJ572560; red clover vein.......

More articles...

Punctodera chalcoensis

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Radopholus Similis

Molecular approach to confirm traditional identification of Radopholus similis sampled in Tanzania External link

Source country exeley Tuesday, March 17, 2020 7:25:00 AM CET | info [other]

Trigger words: [RadopholusSimilis-PHT] Radopholus similis[1];

Other categories:

) to amplify the SSU & ITS1 rDNA regions, respectively, for the preliminary identification of R. similis . Additional species-specific primers were designed including; primers RD1f/RD1r (ACTGAGCCGATTCGAGAAATC/ATGATTTGGAAAAGCTGCCAATTT); RS3ITSF/RS3ITSR (CTGTGAGTCGTGGAGCAGTT/ATGATTTGGAAAAGCTGCCAAT).......

Honghong Wang External link

Source country brill-Nematology Friday, March 6, 2020 4:43:00 AM CET | info [other]

Trigger words: [RadopholusSimilis-PHT] Radopholus similis[1];

Other categories: Aphelenchoides besseyi; Meloidogyne chitwoodi;

Heterodera hainanensis n. sp. is described and illustrated from bamboo ( Phyllostachys pubescens ) based on morphology and molecular analyses of rRNA D2D3 region of LSU and ITS. This new species belongs to the Afenestrata group and is characterised by lemon-shaped cyst with prominent vulval cone and.......

More articles...

Rhagoletis cingulata

Idén ellepnek minket a kártevők? Hogyan készüljünk fel? External link

Source country hirkereso Wednesday, March 25, 2020 5:34:00 PM CET | info English text... [en] [other]

Trigger words: [RhagoletisCingulata-PHT] Rhagoletis cingulata[1];

Entities: Németh Tamás[1]; Andras Horvath[1];

Other categories: Tephritidae;

A körkérdésre ezúttal válaszoltak: AGROVENA Agrokémiai Kft., BASF, Belchim Crop Protection Kft., FMC-Agro Kft., Nufarm Hungária Kft., Syngenta Kft. Rafal Pawlikowski – AGROVENA Agrokémiai Kft. Az elmúlt években Magyarországon a repce termőterületek száma folyamatosan növekedett....

Infested us this year the pest? How do I stand up?

The körkérdésre this time they answered: AGROVENA Agrokémiai Kft., Belchim BASF, Crop Protection Kft., FMC-Agro Kft., Nufarm Delta Kft., Syngenta Kft. Rafal Pawlikowski - AGROVENA Agrokémiai Kft. in recent years the number of the rape production areas in Hungary increased continuously.

First outbreak of Rhagoletis cingulata in Slovenia External link

Source country ippc Wednesday, February 12, 2020 6:37:00 AM CET | info [other]

Trigger words: [RhagoletisCingulata-PHT] Rhagoletis cingulata[4];

Other categories: Tephritidae;

Publication Date: Thu, 02 Aug 2007, 02:00; Last Updated: Aug. 1, 2007, 11:01 a.m. Report Number: SVN-03/3; Country: Slovenia; Pest Id: Rhagoletis cingulata - (RHAGCI) Report Status: Final; Hosts: Prunus cerasus L. Pest Status: Present: at low prevalence; Geographical Distribution: Caught near the.......

More articles...

Rhagoletis fausta

Vŕtajúca sa vrtivka External link

Source country quark Monday, November 18, 2019 7:07:00 AM CET | info [en] [other]

Trigger words: [RhagoletisFausta-PHT] Rhagoletis fausta[1];

Other categories: Rhagoletis completa; Rhagoletis pomonella; Tephritidae;

Foto Pixabay. To, že orech kráľovský patrí medzi odolné stromy, ktoré si po vysadení nevyžadujú zvláštnu ochranu, už prestáva platiť. Jedným z najčastejších ochorení orecha kráľovského (Juglans regia) je černanie plodov. Ochorenie sa nazýva antraknóza orechov a spôsobuje ho huba Gnomonia leptostyla. Prevoz z USA....

More articles...

Rhagoletis indifferens

Laboratory evaluation of CX-10282 containing Beauveria bassiana (Hypocreales: Cordycipitaceae) strain GHA against adult Rhagoletis indifferens (Dipter External link

Source country springer-p Tuesday, March 10, 2020 9:55:00 AM CET | info [other]

Trigger words: [RhagoletisIndifferens-PHT] Rhagoletis indifferens[2]; Western cherry fruit fly[1];

Other categories: Tephritidae; Food Contact Material;

Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherries ( Prunus spp.) in western North America that potentially could be managed using the fungus Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Hypocreales: Cordycipitaceae). Here, the product CX-10282 containing 11....

More articles...

Rhagoletis mendax

Movement of Rhagoletis mendax (Diptera: Tephritidae) in Fruit-Bearing Wild Blueberry Fields. Part II External link

Source country oxforduniversitypress-jee Saturday, March 28, 2020 8:10:00 AM CET | info [other]

Trigger words: [RhagoletisMendax-PHT] blueberry maggot[1]; Rhagoletis mendax[1];

Other categories: Tephritidae;

Abstract During dispersal into fruit-bearing wild blueberry fields, blueberry maggot flies were highly active during all daylight hours as revealed by trap captures, although in one trial afternoon activity was greater than morning activity. Flies were not captured in traps at night, although.......

Effect of Metarhizium anisopliae (Clavicipitaceae) on Rhagoletis mendax (Diptera: Tephritidae) pupae and adults External link

Source country cambridge-entomologist Wednesday, March 25, 2020 11:47:00 AM CET | info [other]

Trigger words: [RhagoletisMendax-PHT] Rhagoletis mendax[3]; Blueberry maggot[1];

Other categories: Tephritidae;

Blueberry maggot ( Rhagoletis mendax Curran (Diptera: Tephritidae)) is a pest of blueberries ( Vaccinium Linnaeus (Ericaceae)). Tephritid flies, including Rhagoletis Loew species, are susceptible to entomopathogenic fungi, but mortality levels depend on life stage targeted....

More articles...

Rhagoletis ribicola

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Rhagoletis suavis

Vrtule ořechová - nový škůdce vlašských ořechů External link

Source country agromanual Tuesday, September 10, 2019 5:27:00 AM CEST | info English text... [en] [other]

Trigger words: [RhagoletisSuavis-PHT] Rhagoletis suavis[1];

Other categories: Tephritidae; Rhagoletis completa;

Rizikové jsou především druhy pocházející se Severní Ameriky a východní Asie (např. mandelinka bramborová - Leptinotarsa decemlineata a octomilka japonská - Drosophila suzukii. Ze Severní Ameriky pochází i vrtule ořechová ( Rhagoletis completa ), která byla na přelomu 80. a 90. let 20....

Propeller walnut - new varmint walnuts

Risk are mainly species originating in north america and eastern asia (e. g. potato weevil - Leptinotarsa decemlineata and octomilka japanese - of Drosophila suzukii. From north america comes and propeller walnut (Rhagoletis completa), which was at the turn of the 1980s and 1990s 20.

More articles...

Rhynchophorus ferrugineus

Echanges mondiaux et santé des plantes : stratégies... External link

Source country phytoma-ldv Friday, April 3, 2020 4:32:00 AM CEST | info English text... [en] [other]

Trigger words: [RhynchophorusFerrugineus-PHT] charançon rouge[1];

Other categories: Bursaphelenchus xylophilus; Xylella fastidiosa;

Les organismes nuisibles n’ont pas de frontières. En santé végétale, comme en santé humaine, la mondialisation implique de coordonner les efforts, en commençant par la prévention. Le14 décembre dernier est entré en application un nouveau règlement (UE 2016/2031) relatif à la santé des végétaux) avec.......

Global trade and health of plants: strategies...

Harmful organisms have no borders. Plant health, as human health, globalisation entails coordinate efforts, starting with prevention. Le14 last December entered under a new regulation (EU 2016/2031) on plant health) with....

Φυτεύτηκαν οι πρώτοι 11 νέοι φοίνικες στη Λεωφόρο Φοινίκων, ... External link

Source country kosnews24 Thursday, April 2, 2020 6:41:00 PM CEST | info English text... [en] [other]

Trigger words: [RhynchophorusFerrugineus-PHT] Rhynchophorus ferrugineus[1];

Other categories:

Οι εργαζόμενοι της Υπηρεσίας Πρασίνου και του εργοταξίου του Δήμου Κω, ξεκίνησαν από το πρωί της Πέμπτης την φύτευση των νέων φοινίκων στη Λεωφόρο Φοινίκων, στην πόλη της Κω. Συγκεκριμένα σήμερα Πέμπτη 2 Απριλίου φυτεύτηκαν 11 νέοι φοίνικες ενώ τις επόμενες ημέρες θα φυτευθούν ακόμη 12, με τους.......

The first 11 new palm trees planted in palm avenue,...

Agency employees are green and the site of the municipality Κω, started from Thursday morning the planting of new palm boulevard in palm 44905 mrth. In particular today thurs­day 2April planted 11 new palm trees will be planted in the coming days, while 12 others, with....

More articles...

Sirococcus tsugae

2020 Disease Update: Optimizing Apple Scab and Fire Blight Management External link

Source country psu Thursday, March 26, 2020 5:15:00 PM CET | info [other]

Trigger words: [SirococcusTsugae-PHT] shoot blight[1];

Other categories: Pesticides; Erwinia Amylovora; Fungicides; Heavy Metals; Additives; Food Contact Material;

Green tip through first cover is a critical time to manage many apple diseases, the most important being apple scab and fire blight. Over the next month, please keep in the mind the following recommendations to successfully manage these diseases. General tips from green tip through first cover From.......

G. S. Pegg External link

Source country springer-onlineFirst Tuesday, March 24, 2020 4:48:00 AM CET | info [other]

Trigger words: [SirococcusTsugae-PHT] shoot blight[3];

Other categories:

Content is preview-only when you or your institution have not yet subscribed to it. By making our abstracts and previews universally accessible we help you purchase only the content that is relevant to you. Austropuccinia psidii (myrtle rust) is one of the most significant threats to plant industries and biodiversity in the Australasian region....

More articles...

Spodoptera eridania

Number 11, November 2018 External link

Source country iapps Wednesday, February 26, 2020 4:56:00 AM CET | info [other]

Trigger words: [SpodopteraEridania-PHT] SOUTHERN ARMYWORM[1]; southern armyworm[6]; Spodoptera eridania[2];

Entities: Innovation Lab[5];

Other categories: Spodoptera litura; Spodoptera frugiperda; Invasive Alien Species; New Plant Pests; Spodoptera littoralis;

Number XI November, 2018 SOUTHERN ARMYWORM, A NEW ALIEN INVASIVE PEST IDENTIFIED IN WEST AND CENTRAL AFRICA Farmers near Ubiaja in south-eastern Nigeria experienced an outbreak of caterpillars that caused severe defoliation on cassava in a 450-hectare field in mid-December 2016....

A Comparison of 13 Sweet Pepper Varieties under an Organic Farming System External link

Source country horttech Monday, February 3, 2020 7:45:00 PM CET | info [other]

Trigger words: [SpodopteraEridania-PHT] Spodoptera eridania[1];

Other categories: Spodoptera frugiperda;

Site background. The study was conducted at the University of Georgia’s UGArden, an organically managed teaching and education farm located in Athens, GA (lat. 33.9519°N, long 83.3576°W) in 2016 and 2017. Soils at this site are categorized as a well-drained acidic [pH 6.37 (2016) and 6....

More articles...

Spodoptera frugiperda

Australia - Fall armyworm detected in the Northern Territories External link

Source country seedquest Thursday, April 2, 2020 7:48:00 PM CEST | info [other]

Trigger words: [SpodopteraFrugiperda-PHT] Fall armyworm[4]; fall armyworm[7]; Spodoptera frugiperda[1]; armyworm[11];

Other categories: New Plant Pests; Yersinia Pestis (Plague); in vitro diagnostic devices; Biodefense; Pesticides; Bacteria;

Australia March 31, 2020. The crop destroying exotic plant pest, fall armyworm ( Spodoptera frugiperda ), was recently detected in Katherine. Four adult moths were located in a trap after a network of surveillance traps were increased in key agricultural areas across the Northern Territory (NT),.......

View Invasive pest fall armyworm confirmed in northern Western Australia External link

Source country seedquest Thursday, April 2, 2020 5:47:00 PM CEST | info [other]

Trigger words: [SpodopteraFrugiperda-PHT] Fall armyworm[2]; fall armyworm[4]; Spodoptera frugiperda[1]; armyworm[6];

Other categories: Biodefense; Pesticides; Pharmaceuticals; Feed;

Western Australia April 2, 2020. The invasive pest fall armyworm Spodoptera frugiperda has been found in northern Western Australia, following detections in Queensland and the Northern Territory. The pest was found in a surveillance trap in Kununurra, operated by the Department of Primary Industries.......

More articles...

Spodoptera litura

Insecticidal activity of isolated phenylpropanoids from Alpinia galanga rhizomes against Spodoptera litura External link

Source country tandfonline-npr Thursday, April 2, 2020 7:56:00 AM CEST | info [other]

Trigger words: [SpodopteraLitura-PHT] Spodoptera litura[2];

Other categories: Insecticides; Multiple Species;

Botanical insecticides as a means of controlling insects present an alternative approach that is safer than the use of synthetic insecticides. The present study identified the insecticidal activity of extracts of the rhizomes of Alpinia galanga (L.) Willd. and seven isolated phenylpropanoids against the second instar of Spodoptera litura Fab....

Fumigant toxicity of essential oil of Hypericum perforatum L., 1753 (Malpighiales: Hypericaceae) to Tenebrio molitor L., 1758 (Coleoptera: Tenebrionid External link

Source country dergipark Monday, March 30, 2020 6:22:00 PM CEST | info [other]

References. Abbott, W., 1925. A method for computing the effectiveness of an insecticide. Journal of Economic Entomology, 18: 265-267. Aebi, H., 1984. Catalase in vitro. Methods in Enzymology, 105: 121-126. Aslanturk, A., S. Kalender, M. Uzunhisarcikli & Y. Kalender, 2011....

More articles...

Strawberry vein banding virus

اصل مقاله 692.88 K External link

Source country jaenph Thursday, February 27, 2020 4:52:00 AM CET | info English text... [en] [other]

Trigger words: [StrawberryVeinBandingVirus-PHT] Strawberry vein banding virus[1];

Entities: حاجي زاده[1];

Other categories: FAO; Escherichia coli Infection; Escherichia;

هاي گياهي بيماري آفات و jaep.2019.125077.1266: DOI/10.22092 8981، شهریور 1، شماره 78جلد فرنگيتوت مزارعاز (Strawberry mottle virus)فرنگي شناسایي مولکولي ویروس پيسک توت NCR΄3 استان کردستان بر اساس منطقه  محمد حاجي زاده، نسرین قادري زندان ‌رانیا‌سنندج،‌،پزشکی‌دانشگاه‌کردستان‌بیماری‌شناسی‌گیاهی‌و‌استادی.......

Out of his article 692.88 K

The Hague گياهي بيماري scourges and jaep.2019.125077.1266: DOI/10.22092 شهریور 1, 8981, شماره 78 فرنگيتوت skin مزارعاز (Strawberry mottle virus(فرنگي شناسایي مولکولي ویروس پيسک tut NCR΄3 Stan کردستان Chinese mainland based on logic  Mohammad Haji Zadah, نسرین Qadri زندان ‌رانیا‌سنندج,‌,پزشکی‌دانشگاه‌کردستان‌بیماری‌شناسی‌گیاهی‌و‌استادی....

Pest categorisation of non‐EU viruses of Fragaria L. External link

Source country efsa Monday, September 30, 2019 3:51:00 PM CEST | info [other]

Trigger words: [StrawberryVeinBandingVirus-PHT] strawberry vein banding virus[1];

Other categories: Strawberry latent ‘C’ virus; EFSA; Tomato ringspot virus; European Food Safety Authority;

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Fragaria L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology....

More articles...

Tecia solanivora

El golpe más duro para el campo External link

Source country eldia Wednesday, March 25, 2020 8:19:00 AM CET | info English text... [en] [other]

Trigger words: [TeciaSolanivora-PHT] polilla de la papa[1];

Entities: Jesús Martín[1]; Ángela Delgado[1]; Carlos Marrero[1];

Other categories: Coronavirus Infection; Other Zoonoses; Colours;

Agricultores y ganaderos se encuentran con que muchos de los canales para comercializar sus productos están cerrados. La apertura de mercadillos municipales ofrece una salida, aunque las dificultades de los clientes para moverse reducen las ventas. El virus es el último varapalo para un sector que.......

The coup more hard to the field

Farmers find that many of the channels to market their products are closed. The opening of municipal bazaars offers a way out, although the difficulties of customers to move reduced sales. The virus is the latest setback for a sector that....

Aardappelsector houdt Q-ziekten beheersbaar External link

Source country boerderij Thursday, February 20, 2020 5:16:00 AM CET | info English text... [en] [other]

Trigger words: [TeciaSolanivora-PHT] Tecia solanivora[1]; aardappelmot[1];

Other categories: Epitrix spp.; Potato spindle tuber viroid; EFSA; Clavibacter michiganensis ssp. sepedonicus;

Virulente AM-aaltjes. Ook al is AM beheersbaar, er zijn wel zorgen over de virulentere aaltjes die een aantal jaren geleden zijn gevonden in het Noordoosten van Nederland waar zetmeelaardappelen worden geteeld. Virulente aaltjes blijken zich te vermeerderen op een perceel, ondanks dat daar een resistent ras wordt geteeld....

Keep manageable Q-ziekten potato sector

Virulent AM-aaltjes. Even though AM manageable, there are concerns about the virulent cysts, which a few years ago have been found in the north-east of the Netherlands which starch potatoes are grown. Nematodes virulent expressions to replicate on a plot‑related, despite there being a resistant variety is grown.

More articles...

Thecaphora solani

PM 3/84 (1) Raising public awareness of Quarantine and Emerging Pests External link

Source country wiley-EPPOb Monday, November 11, 2019 8:24:00 AM CET | info [other]

Trigger words: [ThecaphoraSolani-PHT] potato smut[1]; Thecaphora solani[1];

Other categories: Xylella fastidiosa; Invasive Alien Species;

Examples of awareness‐raising activities targeting different audiences. (A) General public. ‘Xylellu’ campaign on Xylella fastidiosa in Malta on public buses. (B) International travellers. ‘Xylellu’ campaign on Xylella fastidiosa : advertising material displayed at computer/mobile charging stations.......

More articles...

Thrips palmi

Calypso SC 480 External link

Source country agroklub Sunday, March 29, 2020 2:58:00 PM CEST | info English text... [en] [other]

Trigger words: [ThripsPalmi-PHT] Thrips palmi[1];

Other categories: Rhagoletis completa; Tephritidae;

. Calypso sa svojim spektrom djelovanja postavlja nove temelje suvremene zatite bilje. Na voćkama i povrću brzo i učinkovito suzbija sve vrste ui. Izvanredno se brzo upija u biljno tkivo, čime je onemogućeno ispiranje kiom, postojan je i na djelovanje sunčeve svjetlosti....

Calypso SC 480

. Calypso with their range of operations sets new foundation of contemporary issues herbs. The fruit trees and vegetables quickly and efficiently fights all kinds of Trenton. Extraordinary soaks up the plant tissue, which is disabled, irrigation Kia, he's solid, and the action of sunlight.

Shoji Sonoda External link

Source country springer-ez Thursday, March 19, 2020 4:42:00 AM CET | info [other]

Trigger words: [ThripsPalmi-PHT] Melon thrips[1]; Thrips palmi[1];

Other categories: Pesticides; Sodium; Scirtothrips dorsalis; Insecticides; Multiple Species; Food Contact Material;

Content is preview-only when you or your institution have not yet subscribed to it. By making our abstracts and previews universally accessible we help you purchase only the content that is relevant to you. A novel system for spider mite control was developed with a slow-release sachet containing.......

More articles...

Tilletia indica

Assessment of growth, physiological, and yield attributes of wheat cultivar HD 2967 under elevated ozone exposure adopting timely and delayed sowing c External link

Source country springer-espr Monday, March 9, 2020 10:44:00 PM CET | info [other]

Trigger words: [TilletiaIndica-PHT] karnal bunt[1];

Other categories:

Study area. The field experiment was performed between the months of November to mid-April in the year 2016–2017 at the Botanical Garden of the Banaras Hindu University, Varanasi, Uttar Pradesh, (25° 81_N and 83° 1_E) sited at eastern Gangetic plains of India....

PAU expert warns farmers of fungal disease in wheat External link

Source country agropages Monday, March 9, 2020 3:32:00 AM CET | info [other]

Trigger words: [TilletiaIndica-PHT] karnal bunt[2]; Karnal bunt[6];

Other categories:

An expert of Punjab Agricultural University (PAU), Dr Narinder Singh, Head, Department of Plant Pathology, PAU, has advised the farmers to produce karnal bunt-free seed of wheat. “Karnal bunt (KB) of wheat is a fungal disease known to partially transform the wheat grains into black mass of fungal spores....

More articles...

Tobacco ringspot virus

О проведении очередного заседания Ученого совета ФГБУ «ВНИИКР» External link

Source country vniikr Saturday, March 7, 2020 4:38:00 AM CET | info English text... [en] [other]

Trigger words: [TobaccoRingspotVirus-PHT] Tobacco ringspot nepovirus[1];

Other categories: Choristoneura rosaceana; Pesticides;

Цель научно-исследовательской работы заключается в проведение оценки фитосанитарных рисков вредных организмов, связанных с импортированием, экспортированием и перемещением подкарантинной растительной продукции. Задачи данной работы приоритезация перечня вредных организмов, полученного на этапе систематизации и категоризации....

To hold the next meeting know—maybe the'rzsz yegoryevsk ВНИИКР "

Objective research work is to assess the phytosanitary risks of harmful organisms associated with импортированием, подкарантинной экспортированием and movement of plant products. The tasks of this work prioritization of the list of harmful organisms obtained at the stage of systematization and categorization.

О проведении очередного заседания Ученого совета ФГБУ «ВНИИКР» External link

Source country vniikr Wednesday, February 5, 2020 5:14:00 AM CET | info English text... [en] [other]

Trigger words: [TobaccoRingspotVirus-PHT] Tobacco ringspot nepovirus[1];

Other categories: Choristoneura rosaceana; Pesticides;

Цель научно-исследовательской работы заключается в проведение оценки фитосанитарных рисков вредных организмов, связанных с импортированием, экспортированием и перемещением подкарантинной растительной продукции. Задачи данной работы приоритезация перечня вредных организмов, полученного на этапе систематизации и категоризации....

To hold the next meeting know—maybe the'rzsz yegoryevsk ВНИИКР "

Objective research work is to assess the phytosanitary risks of harmful organisms associated with импортированием, подкарантинной экспортированием and movement of plant products. The tasks of this work prioritization of the list of harmful organisms obtained at the stage of systematization and categorization.

More articles...

Trichilogaster acaciaelongifoliae

G. Stancanelli External link

Source country wiley-EPPOb Sunday, January 13, 2019 4:27:00 AM CET | info [other]

Trigger words: [TrichilogasterAcaciaelongifoliae-PHT] Trichilogaster acaciaelongifoliae[2];

Other categories: Invasive Alien Species; EFSA; food security; Equidae; Multiple Species; Environment; Food Contact Material;

Forest insect pests represent a serious threat to European forests and their negative effects could be exacerbated by climate change. This paper illustrates how species distribution modelling integrated with host tree species distribution data can be used to assess forest vulnerability to this threat....

More articles...

Xylella fastidiosa

Echanges mondiaux et santé des plantes : stratégies... External link

Source country phytoma-ldv Friday, April 3, 2020 4:32:00 AM CEST | info English text... [en] [other]

Trigger words: [XylellaFastidiosa-PHT] Xylella fastidiosa[1]; Xylella[1];

Other categories: Bursaphelenchus xylophilus; Rhynchophorus ferrugineus;

Les organismes nuisibles n’ont pas de frontières. En santé végétale, comme en santé humaine, la mondialisation implique de coordonner les efforts, en commençant par la prévention. Le14 décembre dernier est entré en application un nouveau règlement (UE 2016/2031) relatif à la santé des végétaux) avec.......

Global trade and health of plants: strategies...

Harmful organisms have no borders. Plant health, as human health, globalisation entails coordinate efforts, starting with prevention. Le14 last December entered under a new regulation (EU 2016/2031) on plant health) with....

Lavori agricoli, arriva il si dalla Regione: "attività indifferibili" External link

Source country brindisireport Thursday, April 2, 2020 8:08:00 PM CEST | info English text... [en] [other]

Trigger words: [XylellaFastidiosa-PHT] Xylella[2];

Other categories:

La Regione Puglia ha inviato poco fa una nota, trasmessa alla Prefettura la quale, a sua volta l'ha inviata ai sindaci, autorità e Forze dell’Ordine, in risposta alle numerose sollecitazioni arrivate dai primi cittadini e dalle associazioni di categoria, circa la possibilità o meno di affettuare.......

Farm work, comes the it by the region: "attività was"

The apulia region earlier sent a note to the prefecture, which in turn has sent to the mayors, authorities and security forces, in response to a large number of calls received by the first citizens and industry associations, about whether affettuare continue….

More articles...

Acidovorax citrulli

Acidovorax avenae, Bacterial Fruit Blotch of Watermelon External link

Source country freshfromflorida Monday, March 2, 2020 2:20:00 PM CET | info [other]

Trigger words: [AcidovoraxCitrulli-PHT] Acidovorax avenae subsp. citrulli[2];

Entities: Adam H Putnam[1]; Robert Leahy[2];

Other categories: Emerging disease; Pesticides; New Plant Pests; Fungicides; Colours; Food Contact Material;

Bacterial Fruit Blotch of Watermelon Acidovorax avenae subsp. citrulli Robert Leahy, Robert.Leahy@APHIS.USDA.gov, Florida Department of Agriculture & Consumer Services, Division of Plant Industry Bacterial fruit blotch is caused by Acidovorax avenae subsp. citrulli....

Genes, Vol. 11, Pages 220: Development of Molecular Marker Linked with Bacterial Fruit Blotch Resistance in Melon (Cucumis melo L.) External link

Source country mdpi Wednesday, February 19, 2020 4:24:00 PM CET | info [other]

Trigger words: [AcidovoraxCitrulli-PHT] Acidovorax citrulli[1];

Other categories:

Bacterial fruit blotch (BFB) causes losses in melon marketable yield. However, until now, there has been no information about the genetic loci responsible for resistance to the disease or their pattern of inheritance. We determined the inheritance pattern of BFB resistance from a segregating.......

More articles...

Plum line pattern virus

Pest categorisation of non‐EU viruses and viroids of Prunus L. External link

Source country efsa Wednesday, October 23, 2019 8:44:00 AM CEST | info [other]

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Prunus L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology....

Santiago F. Elena External link

Source country microbiologyresearch-jgv Thursday, October 3, 2019 4:45:00 PM CEST | info [other]

Trigger words: [AmericanPlumLinePatternVirus-PHT] American plum line pattern virus[1]; plum line pattern virus[1];

Other categories: Potato leafroll virus; Citrus tristeza virus; GMOs in Environment;

Citrus exocortis viroid (CEVd) populations are composed of closely related haplotypes whose frequencies in the population result from the equilibrium between mutation selection and genetic drift. The genetic diversity of CEVd populations infecting different citrus hosts was studied by comparing.......

More articles...

Anastrepha fraterculus

G. Van Nieuwenhove External link

Source country cambridge-entomological Friday, April 3, 2020 1:23:00 AM CEST | info [other]

Trigger words: [AnastrephaFraterculus-PHT] Anastrepha fraterculus[1];

Other categories: Ricin; Tephritidae; Pesticides; Insecticides; Multiple Species;

Plant-derived compounds can be an environmentally friendly alternative to synthetic pesticide use for pest management. Essential oils (EOs) in several plant families have been found to be toxic to various pest species of insects through topical application, ingestion, and as fumigants....

Laboratorio Nacional de Tratamientos Cuarentenarios External link

Source country ica Thursday, March 26, 2020 4:43:00 AM CET | info English text... [en] [other]

Trigger words: [AnastrephaFraterculus-PHT] Anastrepha fraterculus[4];

Entities: Tommy Atkins[1];

Other categories: Tephritidae; Multiple Species;

Este laboratorio tiene como objetivo principal desarrollar tratamientos cuarentenarios como medida de mitigación de plagas, siguiendo estándares de calidad, con miras a facilitar el acceso de los productos agrícolas Colombianos a los mercados internacionales....

National laboratory Cuarentenarios treatments

This laboratory has as its main objective to develop treatments cuarentenarios as a measure of mitigation of pests, according to quality standards, with a view to facilitate the access of the colombian agricultural products to international markets.

More articles...

Anastrepha obliqua

Plagas como Mosca de la Fruta es constante peligro para la producción de naranja External link

Source country diarioelmercurio Wednesday, April 1, 2020 4:32:00 AM CEST | info English text... [en] [other]

Trigger words: [AnastrephaObliqua-PHT] mosca de la fruta[1]; Mosca de la Fruta[1];

Other categories: Anastrepha suspensa;

Cd. Victoria, Tamps; Ante las posibilidades de registrase precipitaciones pluviales, mismas que ya se están generando en algunas partes de la entidad, el sector citrícola demando la urgencia de instalar revisiones de control fitosanitario pues con la humedad se proliferan plagas como la mosca de la fruta....

Pests as fruit fly is constant danger for the production of orange

Cd. Victory, Tamps; to the possibilities of recorded rainfall rainwater, same as are already generating in some parts of the entity, the citrus sector calling for the urgency to install reviews of plant health check with the humidity shall proliferate pests such as the fruit fly.

Senasa: “China está interesada en importar carne de cerdo y equina del Perú” External link

Source country ElComercio Tuesday, March 31, 2020 2:59:00 PM CEST | info English text... [en] [other]

Trigger words: [AnastrephaObliqua-PHT] mosca de la fruta[1];

Entities: Jorge Montenegro[1];

Other categories: Foot and mouth disease; Coronavirus Infection; Swine Fever; Anastrepha suspensa; Aves; Equidae; Suidae; Other Zoonoses;

Explica que han priorizado actividades en campo asociadas a la importación y exportación de alimentos, el control de enfermedades y plagas de importancia económica y la vacunación y la facilitación de la movilidad de animales. Tampoco han bajado la guardia en apertura de mercados....

Senasa: “China is interested in importing pork and equine” of peru

Explains that have prioritised field activities associated with the import and export of foodstuffs, control of diseases and pests of economic importance and vaccination and facilitating the mobility of animals. Nor have dropped their guard in opening up of markets.

More articles...

Anastrepha suspensa

Plagas como Mosca de la Fruta es constante peligro para la producción de naranja External link

Source country diarioelmercurio Wednesday, April 1, 2020 4:32:00 AM CEST | info English text... [en] [other]

Trigger words: [AnastrephaSuspensa-PHT] mosca de la fruta[1]; Mosca de la Fruta[1];

Other categories: Anastrepha obliqua;

Cd. Victoria, Tamps; Ante las posibilidades de registrase precipitaciones pluviales, mismas que ya se están generando en algunas partes de la entidad, el sector citrícola demando la urgencia de instalar revisiones de control fitosanitario pues con la humedad se proliferan plagas como la mosca de la fruta....

Pests as fruit fly is constant danger for the production of orange

Cd. Victory, Tamps; to the possibilities of recorded rainfall rainwater, same as are already generating in some parts of the entity, the citrus sector calling for the urgency to install reviews of plant health check with the humidity shall proliferate pests such as the fruit fly.

Peach Fruit Fly, Bactrocera Zonata | opens in a new tab External link

Source country freshfromflorida Tuesday, March 31, 2020 8:09:00 PM CEST | info [other]

FDACS-P-01751 Pest Alert revised May 2018PEST ALERT A peach fruit fly, Bactrocera zonata (Saunders) (Tephritidae) Gary J. Steck; Bureau of Entomology, Nematology and Plant Pathology DPIHelpline@FreshFromFlorida.com or 1-888-397-1517 INTRODUCTION: A male peach fruit fly, Bactrocera zonata (Saunders).......

More articles...

Aproceros leucopoda

Be on the lookout for Asian giant hornets this spring and summer External link

Source country news-gov-bc-ca Friday, March 20, 2020 3:41:00 PM CET | info [other]

Trigger words: [AprocerosLeucopoda-PHT] elm sawfly[1];

Other categories:

Residents along 0 Avenue (pronounced as "Zero Avenue"), from Surrey to Aldergrove, are asked to report sightings of Asian giant hornets (Vespa mandarinia) that may emerge from their nests in the coming weeks and months. In December 2019, two specimens were found near Blaine, Wash., and a single specimen was found in White Rock in November 2019....

Pest Alert: Asian Giant Hornet External link

Source country invasivespeciesinfo Wednesday, February 12, 2020 8:53:00 PM CET | info [other]

Trigger words: [AprocerosLeucopoda-PHT] Elm Sawfly[1];

Other categories: Invasive Alien Species; Nutrition Allergens;

September 2019 Asian Hornet (Vespa mandarinia) Pest Alert: Asian Giant Hornet Three Asian Hornets (Vespa mandarinia) were found in the Nanaimo area on Vancouver Island in mid-August. The identification has been confirmed by Canadian and international experts. This is the first time this insect has been found in British Columbia....

More articles...

Aromia bungii

Japan's cherry blossoms under threat from hungry rats who can't find acorns in its southern islands External link

Source country AsiaOne Tuesday, March 10, 2020 4:29:00 AM CET | info [other]

Trigger words: [AromiaBungii-PHT] aromia bungii[1];

Other categories: Pesticides;

The much-anticipated cherry blossom season on two of Japan's most southerly islands is under threat from an unexpected source - rare indigenous rats that are on the brink of starvation. The Ryukyu long-haired rats are only found on the islands of Amami-Oshima and Tokunoshima, off Kagoshima Prefecture, and typically feed on acorns....

Invazivni hrošč ogroža slovite japonske češnje External link

Source country demokracija Tuesday, March 10, 2020 12:22:00 AM CET | info [en] [other]

Trigger words: [AromiaBungii-PHT] Aromia bungii[1];

Other categories:

Gre za vrsto rdečevratni kozliček (Aromia bungii), ki živi na Kitajskem, Tajvanu, Korejskem polotoku in severu Vietnama. Ti hrošči živijo na češnjah in slivah ter uničujejo njihovo lubje. Ker lahko drevo v primeru hujšega napada odmre, strokovnjaki bijejo plat zvona....

More articles...

Arracacha virus B, oca strain

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “ Satsumavirus ”, “ Stramovirus ” and “ Cholivirus ”, in the genus Sad External link

Source country springer-av Friday, January 31, 2020 8:24:00 AM CET | info [other]

Fig. 1. Maximum-likelihood phylogenetic analysis of the Pro-Pol amino acid sequence of type isolates from recognized species in the family Secoviridae . The alignment was generated using ClustalW in MEGA X, the tree was also built in MEGA X. Bootstrap values for each node are shown (1000 replicates)....

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “ Satsumavirus ”, “ Stramovirus ” and “ Cholivirus ”, in the genus Sad External link

Source country springer-av Tuesday, December 17, 2019 9:36:00 AM CET | info [other]

Fig. 1. Maximum-likelihood phylogenetic analysis of the Pro-Pol amino acid sequence of type isolates from recognized species in the family Secoviridae . The alignment was generated using ClustalW in MEGA X, the tree was also built in MEGA X. Bootstrap values for each node are shown (1000 replicates)....

More articles...

Arrhenodes minutus

Pest categorisation of Arrhenodes minutus External link

Source country efsa Wednesday, February 27, 2019 12:42:00 PM CET | info [other]

The Panel on Plant Health performed a pest categorisation of Arrhenodes minutus , a well‐defined wood‐boring insect species in the family Brentidae (Insecta: Coleoptera). It can be identified using taxonomic keys. A. minutus is only present in southern Canada and eastern USA down to Florida. The main host plants of A....

More articles...

Zeugodacus cucurbitae

M. Frommer External link

Source country cambridge-entomological Sunday, October 27, 2019 6:15:00 PM CET | info [other]

Trigger words: [BactroceraCucurbitae-PHT] Bactrocera[1];

Other categories: Bactrocera tsuneonis; Bactrocera tryoni; Multiple Species;

Semi-insulating polycrystalline silicon films have been used as matching layers in micro-zone-melting recrystallization experiments of silicon-on-insulator (SOI) structures. The effect of the laser irradiation on the structural composition and crystallographic properties has been investigated by.......

J.A. Sved External link

Source country cambridge-entomological Sunday, October 27, 2019 6:15:00 PM CET | info [other]

Trigger words: [BactroceraCucurbitae-PHT] Bactrocera[2];

Other categories: New Plant Pests; Bactrocera tryoni; Endemic; Bactrocera tsuneonis; Multiple Species;

Since 1985, a new and serious fruit fly pest has been reported in northwestern Australia. It has been unclear whether this pest was the supposedly benign endemic species, Bactrocera aquilonis , or a recent introduction of the morphologically near-identical Queensland fruit fly, B. tryoni B....

More articles...

Bactrocera dorsalis

Announcement: Capacity Development pre-CPM training session and CPM-9 side sessions External link

Source country ippc Wednesday, April 1, 2020 5:29:00 AM CEST | info [other]

Trigger words: [BactroceraDorsalis-PHT] Bactrocera dorsalis[2];

Other categories: Bactrocera tsuneonis; food security; New Plant Pests; Rhynchophorus ferrugineus; FAO; Environment; Food Contact Material;

A capacity development training session and range of side sessions will take place during the week of the ninth session of the Commission on the Phytosanitary Measures (30 March- 4 of April 2014) at FAO headquarters in Rome, Italy. The training session will take place on the Sunday before the CPM,.......

Four devastating fruit flies pests are one and the same species External link

Source country ippc Wednesday, April 1, 2020 5:29:00 AM CEST | info [other]

Trigger words: [BactroceraDorsalis-PHT] oriental fruit fly[1]; Bactrocera dorsalis[1];

Entities: Scott Bauer[1];

Other categories: Bactrocera tsuneonis; Pesticides; Tephritidae; FAO; Multiple Species;

A female oriental fruit fly, Bactrocera dorsalis, laying eggs by inserting her ovipositor in the skin of a papaya. Image by Scott Bauer. What difference could it possibly make if a bunch of scientists decided that what were once thought of as four different species of fruit fly actually belong to.......

More articles...

Bactrocera tsuneonis

Adaf mantém ação de prevenção contra mosca-da-carambola na barreira em Roraima External link

Source country g1-globo Thursday, April 2, 2020 9:24:00 PM CEST | info English text... [en] [other]

Trigger words: [BactroceraTsuneonis-PHT] Bactrocera[1];

Entities: Luiz Fernando[1];

Other categories: Coronavirus Infection;

A Agência de Defesa Agropecuária e Florestal do Estado do Amazonas (Adaf) tem executado a fiscalização do trânsito interestadual de vegetais e suas partes na Barreira de Vigilância Agropecuária (BVA) localizada em Jundiá, no município de Rorainopolis (RR), alinhados com o Programa Nacional de.......

Adaf agriculturally-economically assessment in prevention against mosca-da-carambola Barreira in roraima

The defence agency Agropecuária and forestry of the amazon state (Adaf) has implemented the transit state surveillance of plants and parts thereof in barrier surveillance Agropecuária (BVA) located in Jundiá, in the municipality of Rorainopolis (RR), aligned with the national programme of....

Epik<sup>®</sup> SL su olivo: un solo prodotto per quattro parassiti External link

Source country agronotizie Wednesday, April 1, 2020 10:48:00 AM CEST | info English text... [en] [other]

Trigger words: [BactroceraTsuneonis-PHT] Bactrocera[1];

Other categories: Xylella fastidiosa; Insecticides;

Epik SL su olivo: un solo prodotto per quattro parassiti Efficace e selettivo, l'insetticida di Sipcam Italia vanta in etichetta tutti e quattro gli insetti chiave che affliggono l'olivo: mosca, tignola, sputacchina e cecidomia. Difficile fare poker con un solo prodotto....

Epik 'sup' ® '/sup' SL on tree: only one product for four pests

Epik SL on tree: only one product for four parasites and efficientoperation selettivo, insecticide of Sipcam vegyvizsgáló etichetta has all four key insectes plaguing the tree: moscow, tignola, sputacchina and cecidomia. Difficult to poker with one single product.

More articles...

Bactrocera zonata

Peach Fruit Fly, Bactrocera Zonata | opens in a new tab External link

Source country freshfromflorida Tuesday, March 31, 2020 8:09:00 PM CEST | info [other]

Trigger words: [BactroceraZonata-PHT] guava fruit fly[2]; Bactrocera zonata[6]; Bactrocera) zonata[1]; peach fruit fly[5]; Bactrocera Zonata[1]; Peach Fruit Fly[2];

Entities: Indian Ocean[1];

Other categories: Bactrocera tsuneonis; Pesticides; New Plant Pests; Tephritidae; Anastrepha suspensa; Bactrocera dorsalis; Methyl; Insecticides; Aves; Multiple Species; Colours;

FDACS-P-01751 Pest Alert revised May 2018PEST ALERT A peach fruit fly, Bactrocera zonata (Saunders) (Tephritidae) Gary J. Steck; Bureau of Entomology, Nematology and Plant Pathology DPIHelpline@FreshFromFlorida.com or 1-888-397-1517 INTRODUCTION: A male peach fruit fly, Bactrocera zonata (Saunders).......

Exported kinnow price up 18 times in China External link

Source country tribune Saturday, March 14, 2020 4:52:00 AM CET | info [other]

Trigger words: [BactroceraZonata-PHT] bactrocera zonata[1];

Entities: Zhao Yong[1];

Other categories: Coronavirus Infection; Epidemic; Bactrocera tsuneonis; Bactrocera dorsalis; Other Zoonoses;

Quotes... Quotes in this article

Zhao Yong said: “The cold storage data is not available to the public which is the shipping company’s regulation. This time, Orient Overseas Container Line, which was acquired by China Ocean Shipping Company two years ago, helped a lot,” “There is a slight deviation in our cold storage data, but according to the protocol between the two countries, the range of plus or minus 0.1 degrees is allowed”

BEIJING: The kinnow from Sargodha, available at Rs25 per kg, are now being sold for 19.96 yuan on the e-commerce platforms in China. This translates to about Rs455, around 18 times the price in Pakistan. After a month-long sea transport, 2,650 boxes of Pakistani kinnow reached northeast China’s Dalian port for customs clearance on February 21....

More articles...

Bean golden mosaic virus

Seasonal Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) MEAM1 Species and Impact on Incidence of Begomoviral Diseases in Baja California Sur External link

Source country bioone Saturday, February 8, 2020 7:20:00 AM CET | info [other]

Trigger words: [BeanGoldenMosaicVirus-PHT] bean golden mosaic virus[1]; Bean golden mosaic virus[2];

Other categories: Bemisia Tabaci;

For more than four decades, the presence of the whitefly Bemisia tabaci Gennadius complex as a pest and transmitter of begomoviral diseases has been one of the most important phytopathological events in cultivated species worldwide. In addition, the number of whitefly species, as well as the viruses they transmit, has been increasing over time....

Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil External link

Source country springer-av Saturday, January 11, 2020 10:35:00 AM CET | info [other]

Trigger words: [BeanGoldenMosaicVirus-PHT] bean golden mosaic virus[1];

Other categories: Squash leaf curl virus; Tomato mottle virus; Bemisia Tabaci;

Fig. 1. Bayesian phylogenetic consensus trees constructed using the complete nucleotide sequences of the DNA-A (A) and DNA-B (B) components of sida yellow golden mosaic virus (SiYGMV), a new bipartite begomovirus infecting Sida sp. in the state of Piaui in Northeastern Brazil, and the most closely related begomoviruses....

More articles...

Blueberry leaf mottle virus

Pest categorisation of non‐EU viruses and viroids of Vitis L. External link

Source country efsa Sunday, October 20, 2019 11:03:00 PM CEST | info [other]

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Vitis L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology....

More articles...

Botryosphaeria laricina

Pest categorisation of Guignardia laricina External link

Source country efsa Friday, June 1, 2018 12:07:00 PM CEST | info [other]

Trigger words: [BotryosphaeriaLaricina-PHT] Guignardia laricina[2];

Other categories: EFSA; Sirococcus tsugae; European Food Safety Authority;

Following a request from the European Commission, the EFSA Panel on Plant Health performed a pest categorisation of Guignardia laricina , a well‐defined and distinguishable fungal species of the family Phyllostictaceae. The pathogen is regulated in Council Directive 2000/29/EC (Annex IAI) as a.......

More articles...

Candidatus Arsenophonus phytopathogenicus

Betteraviers vaudois toujours à la peine External link

Source country 24heures Sunday, February 9, 2020 8:42:00 AM CET | info English text... [en] [other]

Trigger words: [CandidatusArsenophonusPhytopathogenicus-PHT] syndrome des basses richesses[1];

Entities: Josef Meyer[2]; Nicolas Vincent[1];

Other categories:

Quotes... Quotes in this article

Josef Meyer présenté: «Nous avons pu maintenir le prix de base, mais les primes versées sur la qualité sont en nette baisse»

Josef Meyer répondu: «L’idée est de gagner des régions où il n’y a pas de planteurs pour maintenir les deux usines d’Aarberg et Frauenfeld en activité et moins importer»

«Le risque financier pour le betteravier devient trop grand». Président de l’Association des planteurs de betterave à sucre de la Broye vaudoise, Nicolas Vincent a résumé, jeudi à Corcelles-près-Payerne, la déprime que vivent les cultivateurs. Après une année 2018 catastrophique en raison,.......

Beet growers vaudois always penalty

"The financial risk to the betteravier becomes too great." President of the Association of growers of sugar beet of the crushed vaudoise, Nicolas Vincent a summary, Thursday to Corcelles-près-Payerne, the depression that live growers. After a disastrous year 2018 because....

More articles...

Candidatus Phytoplasma fragariae

Phytoplasmas associated with declining of hazelnut ( Corylus avellana ) in Slovenia External link

Source country springer-ejpp Thursday, November 14, 2019 1:28:00 PM CET | info [other]

Trigger words: [CandidatusPhytoplasmaFragariae-PHT] Phytoplasma fragariae[1]; Candidatus Phytoplasma fragariae[1];

Entities: Prof Dr[1];

Other categories: Flavescence dorée;

Abstract. Hazelnut ( Corylus avellana ) is cultivated on 118 ha and ranks eighth in Slovenian fruit growing production, representing 2.8% of the total area of fruit plantations in the country. However, decline of some of the trees appeared in 2012 in two plantations located in eastern Slovenia....

Detection and molecular characterization of a phytoplasma in Eclipta prostrata in China External link

Source country springer-jgpp Friday, January 10, 2020 12:20:00 PM CET | info [other]

Trigger words: [CandidatusPhytoplasmaFragariae-PHT] potato witches[1];

Other categories:

For further confirmation of phytoplasma infection, the PCR amplicons were purified. After ‘A’ was added to the C terminus, the fragments of the 16S rRNA gene and rp gene were cloned into pMD19-T vector (Takara Biotechnology, Dalian, China). The recombinant vectors were then inserted into DH5α competent cells....

More articles...

Candidatus Phytoplasma pruni

Multilocus Characterization, Gene Expression Analysis of Putative Immunodominant Protein Coding Regions, and Development of Recombinase Polymerase Amp External link

Source country apsjournals-phyto Thursday, April 25, 2019 9:17:00 AM CEST | info [other]

Trigger words: [CandidatusPhytoplasmaPruni-PHT] Candidatus Phytoplasma Pruni[1]; Phytoplasma pruni[5]; Phytoplasma Pruni[1]; Candidatus Phytoplasma pruni[1];

Other categories: New Plant Pests; Flavescence dorée;

Western X (WX) disease, caused by ‘ Candidatus Phytoplasma pruni’, is a devastating disease of sweet cherry resulting in the production of small, bitter-flavored fruits that are unmarketable. Escalation of WX disease in Washington State prompted the development of a rapid detection assay based on.......

First Report of North American Grapevine Yellows (NAGY) in Kansas: Detection of ‘ Candidatus Phytoplasma pruni’- and ‘ Ca . Phytoplasma asteris’-Relat External link

Source country apsjournals-pdis Wednesday, April 10, 2019 8:52:00 PM CEST | info [other]

Trigger words: [CandidatusPhytoplasmaPruni-PHT] Phytoplasma pruni[1]; Candidatus Phytoplasma pruni[1];

Other categories:

During surveillance for possible presence of exotic phytoplasma pathogens in the United States, plants of cultivated grapevine ( Vitis vinifera L.) exhibiting symptoms suggestive of grapevine yellows disease were observed in vineyards in Kansas during the 2013 and 2014 growing seasons....

More articles...

Candidatus Phytoplasma solani

Albert Londres, taccuini della lontananza External link

Source country ilmanifesto Tuesday, March 17, 2020 12:12:00 AM CET | info English text... [en] [other]

Trigger words: [CandidatusPhytoplasmaSolani-PHT] legno nero[1];

Entities: Sol Levante[1]; Albert Londres[4]; Hunter S Thompson[1]; Howard Thompson[1]; Roberta Alexander[1];

Other categories:

Nel 2017 Le Figaro , complice l’uscita di un nuovo libro sul caso, si chiedeva: «È morto annegato o asfissiato nella sua cabina? Il fuoco sul piroscafo Georges-Philippar è accidentale o criminale?». Protagonista della domanda è Albert Londres, celebre giornalista francese, scomparso in.......

Albert Londres, notebooks of remoteness

Le Figaro in 2017, in collusion with the exit of a new book on the case, wondered: d'utilité asfissiato drowned or died in his cab? The fire on the liner Georges-Philippar is accidental or criminal. Leader of the application is Albert Londres, renowned french journalist, who disappeared in....

Stolbur rajčiaka nielen na rajčiakoch External link

Source country rno Monday, March 9, 2020 1:24:00 PM CET | info [en] [other]

Trigger words: [CandidatusPhytoplasmaSolani-PHT] Stolbur[3]; stolbur phytoplasma[1]; stolbur[1];

Other categories:

. Stolbur rajčiaka (Tomato stolbur phytoplasma), ako hospodársky veľmi nebezpečné ochorenie, napáda nielen rajčiak jedlý, ale aj papriku ročnú, zemiak, pupenec roľný a mnohé ďalšie druhy, ktoré patria do čeľade ľuľkovitých (Solanaceae), prýštecovitých (Euphorbiaceae), mrkvovitých (Daucaceae) a kukučinovitých (Cuscutaceae)....

More articles...

Ceratitis quinaria

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Ceratitis rosa

El alcalde de Miami se recuperó del coronavirus y contó su experiencia: “Es una pandemia espantosa” External link

Source country infobae Wednesday, April 1, 2020 4:41:00 PM CEST | info English text... [en] [other]

Trigger words: [CeratitisRosa-PHT] natal Florida[1];

Entities: Francis Suarez[1];

Other categories: Coronavirus Infection; Other Zoonoses;

Casi veinte días atrás cuando la crisis por el coronavirus parecía un conflico que sólo afectaba realmente a asiáticos y europeos, Estados Unidos puso el primer rostro público propio a esta pandemia: el Alcalde de Miami Francis Suarez , se convertía en el primer oficial electo en resultar positivo en la prueba del coronavirus....

The mayor of Miami recovered from sars-coronavirus told and experience: “appalling” is a pandemic

Nearly twenty days ago when the crisis by the coronavirus seemed a conflico that only really affected asian and european, the united states was the first public face own this pandemic: the mayor of Miami Francis Suarez, becoming the first elected official in prove positive proof of coronavirus.

Embriagado e dirigindo na contramão, homem é preso pela PRF na Grande Natal External link

Source country g1-globo Thursday, March 26, 2020 2:09:00 PM CET | info English text... [en] [other]

Trigger words: [CeratitisRosa-PHT] Natal. Flagrado[1];

Other categories:

Flagrado embriagado e dirigindo um carro na contramão, um homem foi preso pela Polícia Rodoviária Federal na noite desta quarta-feira (25), próximo à BR 101, em Goianinha, região metropolitana de Natal. Ainda de acordo com a corporação, o homem sequer era habilitado....

Drunken and addressing in severely man is arrested by PRF in great christmas

Drunken Flagrado and addressing a car in severely, a man was arrested on Federal road police on the evening of Wednesday (25), near the BR 101, in Goianinha, metropolitan region christmas. Again, according to the corporation, the man was not authorized.

More articles...

Cherry rasp leaf virus

Biological properties and genomic sequence of an isolate of cherry rasp leaf virus from tomato External link

Source country springer-jpp Monday, February 24, 2020 6:28:00 PM CET | info [other]

Trigger words: [CherryRaspLeafVirus-PHT] cherry rasp leaf virus[1]; Cherry rasp leaf virus[1];

Other categories:

Cherry rasp leaf virus (CRLV) is found in the USA causing disease in Prunus and Malus spp. In 2016, symptomatic high tunnel grown tomatoes ( Solanum lycopersicum L.) from Minnesota exhibiting viral symptoms were found to contain ~30 nm spherical particles....

U.S. stocks largely weaker, greenback in demand External link

Source country irishsun Tuesday, February 18, 2020 10:22:00 PM CET | info [other]

Trigger words: [CherryRaspLeafVirus-PHT] flat. Apple[1];

Entities: Quincy Krosby[1];

Other categories: Coronavirus Infection; Other Zoonoses;

The Dow Jones dropped 165.89 points or 0.56% to 29,232.19. The Standard and Poor's 500 fell 9.87 points or 0.29% to 3,370.29. The Nasdaq Composite made a small 1.57 points or 0.02% gain, to close flat at 9,732.74. NEW YORK, New York - Wall Street was sharply weaker on Tuesday, joining a global meltdown in stocks....

More articles...

Chrysomyxa arctostaphyli

Pest categorisation of Chrysomyxa arctostaphyli External link

Source country efsa Tuesday, July 17, 2018 11:24:00 PM CEST | info [other]

Trigger words: [ChrysomyxaArctostaphyli-PHT] Chrysomyxa arctostaphyli[2];

Entities: Van Bruggen[1]; Vittorio Rossi[1]; Sylvie van der Werf[1]; Jonathan West[1];

Other categories: EFSA; European Food Safety Authority;

Following a request from the European Commission, the EFSA Panel on Plant Health performed a pest categorisation of Chrysomyxa arctostaphyli, a well‐defined and distinguishable fungal species of the family Coleosporiaceae. The pathogen is regulated in Council Directive 2000/29/EC (Annex IAI) as a.......

More articles...

Conotrachelus nenuphar

Five new IPPC Diagnostic Protocols adopted! External link

Source country ippc Wednesday, April 1, 2020 5:29:00 AM CEST | info [other]

Trigger words: [ConotrachelusNenuphar-PHT] Conotrachelus nenuphar[4];

Other categories: Xylella fastidiosa; New Plant Pests; Multiple Species; Feed; Food Contact Material;

**The IPPC Secretariat is happy to announce** that five new diagnostic protocols (DPs) have been adopted by the Standards Committee (SC) on behalf of the Commission on Phytosanitary Measures (CPM) as the DP Notification Period just closed on 15 August 2018....

Entomology Update: Early Start to the 2020 Season External link

Source country farms Saturday, March 28, 2020 5:15:00 AM CET | info [other]

Trigger words: [ConotrachelusNenuphar-PHT] plum curculio[1];

Other categories: Pesticides; Insecticides; Heavy Metals; Apidae; Multiple Species; Feed;

By Grzegorz Krawczyk. The apricots and plums are in bloom while the peach buds are ready to burst as well. As the development of most insect pests is almost directly correlated to the outside temperatures and development of their host plants, this season's warm weather is likely to cause earlier than normal occurrence of fruit pests....

More articles...

Dacus ciliatus

Web report of the 6 th Meeting of the EPPO Panel on Diagnostics in Entomology (Paris, 2020-03-03/05) External link

Source country eppo Friday, March 13, 2020 4:59:00 AM CET | info [other]

6 th Meeting of the EPPO Panel on Diagnostics in Entomology Paris, 2020-03-03/05. The 6 th meeting of the EPPO Panel on Diagnostics in Entomology took place in the Headquarters of the European and Mediterranean Plant Protection Organization in Paris. The EPPO Secretariat was pleased to welcome new.......

Fruit fly (Diptera: Tephritidae) fauna of Çorum and Sinop Provinces with two new records for Turkey External link

Source country dergipark Wednesday, December 11, 2019 7:24:00 AM CET | info [other]

Trigger words: [DacusCiliatus-PHT] Dacus ciliatus[1];

Entities: Ana Bilim Dalı[1];

Other categories: Tephritidae; Invasive Alien Species;

References. Çalışkan Keçe, A. F., B. Ö. Çatal & M. R. Ulusoy, 2019. A new invasive species in Turkey: Dacus ciliatus Loew, 1862 (Diptera: Tephritidae). Turkish Journal of Entomology. 43 (1): 25-30. Freidberg, A., 2016. New taxa of Carpomyini, with special emphasis on Goniglossum (Diptera: Tephritidae: Trypetinae)....

More articles...

Diabrotica barberi

Los precios del maíz a la baja tras la paralización del acuerdo comercial entre China y EEUU External link

Source country ecomercioagrario Friday, March 13, 2020 8:16:00 AM CET | info English text... [en] [other]

Trigger words: [DiabroticaBarberi-PHT] gusano de la raíz del maíz[1];

Entities: Roberto Martín[1];

Other categories: Water Stress; Coronavirus Infection; Diabrotica virgifera;

Quotes... Quotes in this article

Roberto Martín señala: “Por tanto, durante los próximos meses es importante estar atentos a estas variables que podrían generar volatilidad en el mercado del maíz”

Roberto Martín comenta: “Esta paralización del acuerdo comercial hace que no exista demanda de productos agrícolas por parte de China y esto afecta muy negativamente a las cotizaciones de los cereales en los mercados al no estar presente una gran demanda como es China”

Roberto Martín señala: “Cualquier decisión que se adopte en materia de favorecer acuerdos comerciales, uso de etanol, subvenciones, etc. tendrá su repercusión en cuanto al consumo, oferta y en el comportamiento a la hora de elegir un cultivo u otro”

La cosecha de maíz Sudamericana, con muy buenas perspectivas, arroja unas cifras de cosecha de 50 millones de toneladas para Argentina y de 101 millones de toneladas para Brasil con unos niveles de exportación de 33,50 y 36 millones de toneladas respectivamente....

Maize prices low after the cessation of the trade agreement between China and the us

The south american maize harvest, with very good prospects, leads to figures of harvest of 50 million tonnes for Argentina and 101 million tonnes to brazil with levels of export of 33,50 and 36 million tonnes respectively.

Choroby kukuřice (1): Virové a bakteriální choroby External link

Source country agromanual Tuesday, March 3, 2020 5:26:00 AM CET | info English text... [en] [other]

Trigger words: [DiabroticaBarberi-PHT] Diabrotica longicornis[1];

Other categories:

. 03. 03. 2020 Ing. Jana Víchová, Ph.D.; Mendelova univerzita v Brně Zobrazeno 26x. Napadení kukuřice virovými patogeny může vzhledem k pozdní sklizni porostu představovat významný zdroj infekce pro ozimé obilniny. Infekce často probíhá bez příznaků, a tím nám uniká pozornosti....

Disease maize (1): viral and bacterial disease

...... 03.03.2020 Ing. Jana Víchová, Ph. D.; mendel university in brno displayed 26x. Of maize viral pathogens in view of the late harvest crops may be a significant source of infection for winter cereals. The infection is often undertaken without symptoms, and the us uniká attention.

More articles...

Diabrotica undecimpunctata howardi

Southern Corn Rootworm (Coleoptera: Chrysomelidae) Adult Emergence and Population Growth Assessment After Selection With Vacuolar ATPase-A double-stra External link

Source country bioone Saturday, February 8, 2020 7:20:00 AM CET | info [other]

Trigger words: [DiabroticaUndecimpunctataHowardi-PHT] southern corn rootworm[2]; Southern Corn Rootworm[1]; Diabrotica undecimpunctata howardi[1];

Other categories: Diabrotica undecimpunctata undecimpunctata; GMOs in Environment;

The southern corn rootworm, Diabrotica undecimpunctata howardi Barber (Coleoptera: Chrysomelidae), was exposed over multiple generations to vacuolar (v)ATPase-A double-stranded (ds)RNA, first as adults and later, as neonate larvae. During adult selection, high mortality and lower fecundity were.......

Characterization of the Spectrum of Insecticidal Activity for IPD072Aa: A Protein Derived from Psuedomonas chlororaphis with Activity Against Diabroti External link

Source country bioone Saturday, January 4, 2020 4:24:00 AM CET | info [other]

Trigger words: [DiabroticaUndecimpunctataHowardi-PHT] southern corn rootworm[1]; Diabrotica undecimpunctata howardi[1];

Entities: De Geer[1];

Other categories: Diabrotica virgifera; Helicoverpa zea; Diabrotica undecimpunctata undecimpunctata;

Species Selection. Species were selected for testing with IPD072Aa based on several criteria: relatedness to WCR, established laboratory bioassay methodologies, availability of laboratory reared insects, a known suitable diet, and laboratory performance, and reproducibility of the response variables.......

More articles...

Diabrotica undecimpunctata undecimpunctata

Southern Corn Rootworm (Coleoptera: Chrysomelidae) Adult Emergence and Population Growth Assessment After Selection With Vacuolar ATPase-A double-stra External link

Source country bioone Saturday, February 8, 2020 7:20:00 AM CET | info [other]

Trigger words: [DiabroticaUndecimpunctataUndecimpunctata-PHT] Diabrotica undecimpunctata[1];

Other categories: Diabrotica undecimpunctata howardi; GMOs in Environment;

The southern corn rootworm, Diabrotica undecimpunctata howardi Barber (Coleoptera: Chrysomelidae), was exposed over multiple generations to vacuolar (v)ATPase-A double-stranded (ds)RNA, first as adults and later, as neonate larvae. During adult selection, high mortality and lower fecundity were.......

Characterization of the Spectrum of Insecticidal Activity for IPD072Aa: A Protein Derived from Psuedomonas chlororaphis with Activity Against Diabroti External link

Source country bioone Saturday, January 4, 2020 4:24:00 AM CET | info [other]

Trigger words: [DiabroticaUndecimpunctataUndecimpunctata-PHT] Diabrotica undecimpunctata[1];

Entities: De Geer[1];

Other categories: Diabrotica virgifera; Helicoverpa zea; Diabrotica undecimpunctata howardi;

Species Selection. Species were selected for testing with IPD072Aa based on several criteria: relatedness to WCR, established laboratory bioassay methodologies, availability of laboratory reared insects, a known suitable diet, and laboratory performance, and reproducibility of the response variables.......

More articles...

Category for the Dryocosmus kuriphilus plant health threat

Una helada de hasta tres grados bajo cero pone en jaque a los fruticultores External link

Source country diariodeleon Saturday, March 28, 2020 9:30:00 AM CET | info English text... [en] [other]

Trigger words: [DryocosmusKuriphilus-PHT] avispilla del castaño[1];

Entities: Pablo Linares[3];

Other categories:

Quotes... Quotes in this article

Pablo Linares afirmó: «en diez días se verán los efectos, pero ante esta cantidad de horas helando y estas temperaturas, daño ha causado seguro»

Pablo Linares aseguró: «Se están repitiendo mucho las condiciones que se dieron en 2017»

Pablo Linares aseguró: «En principio, todo se mantiene. Los pedidos de Torymus sinensis estaban hechos antes de que pasara todo esto y confiamos en que puedan llegar de Italia, que no haya problemas con el transporte»

La madrugada del 26 al 27 de abril del 2017 marcó un antes y un después en el campo berciano. Fue una catástrofe. Una gran helada, acompañada de viento seco y frío, arrasó los cultivos mermando las producciones de fruta y vino a mínimos nunca antes registrados....

A frost of up to three degrees below zero wrings to fruit growers

The night of 26 to 27 April 2017 marked a 'before' and an 'after' in the field berciano. It was a disaster. A great frost, accompanied by dry wind and cold, flattened crops eating into the production of fruit and wine to a minimum never before recorded.

COLDIRETTI, TORNANO LE CA External link

Source country ilperiodiconews Saturday, March 21, 2020 12:45:00 PM CET | info English text... [en] [other]

Trigger words: [DryocosmusKuriphilus-PHT] cinipide galligeno del castagno[1];

Other categories: Multiple Species;

Dopo aver rischiato la scomparsa, tornano le castagne italiane con un raccolto stimato quest'autunno superiore a 30 milioni di chili. Si tratta di un aumento dell'80% rispetto a cinque anni fa, quando era stato raggiunto il minimo storico di 18 milioni di chili a causa della strage provocata da un.......

Coldiretti, return the ca

Having put their disappearance, come home with an italian chestnuts raccolto stimato this autumn exceeding 30 million kilos. This represents an increase of 80% compared to five years ago, when it was at a record low of 18 million tons due to the carnage caused by an....

More articles...

Candidatus Phytoplasma ulmi

First Report of ‘ Candidatus Phytoplasma ulmi’ on Elm in Belgium External link

Source country apsjournals-pdis Thursday, June 20, 2019 8:28:00 PM CEST | info [other]

Trigger words: [ElmYellowsPhytoplasma-PHT] Phytoplasma ulmi[2];

Other categories: in vitro diagnostic devices;

In April 2017, the project ‘Belgian Plant Sentinel Network’ started as part of the Euphresco-IPSN2 network. The botanical gardens and arboreta of the network contain diverse plant collections with both exotic and native taxa that can be used as sentinels by recording their sensitivity to either native or to (newly) introduced pests and diseases....

More articles...

Epitrix spp.

Aardappelsector houdt Q-ziekten beheersbaar External link

Source country boerderij Thursday, February 20, 2020 5:16:00 AM CET | info English text... [en] [other]

Trigger words: [Epitrix-PHT] Epitrix spp[1];

Other categories: Potato spindle tuber viroid; EFSA; Tecia solanivora; Clavibacter michiganensis ssp. sepedonicus;

Virulente AM-aaltjes. Ook al is AM beheersbaar, er zijn wel zorgen over de virulentere aaltjes die een aantal jaren geleden zijn gevonden in het Noordoosten van Nederland waar zetmeelaardappelen worden geteeld. Virulente aaltjes blijken zich te vermeerderen op een perceel, ondanks dat daar een resistent ras wordt geteeld....

Keep manageable Q-ziekten potato sector

Virulent AM-aaltjes. Even though AM manageable, there are concerns about the virulent cysts, which a few years ago have been found in the north-east of the Netherlands which starch potatoes are grown. Nematodes virulent expressions to replicate on a plot‑related, despite there being a resistant variety is grown.

Verandering in klimaat kan nieuwe fytosanitaire risico’s voor de aardappelsector opleveren External link

Source country agriholland Wednesday, February 19, 2020 1:09:00 PM CET | info English text... [en] [other]

Trigger words: [Epitrix-PHT] Epitrix spp[1];

Entities: Van Spanje[1];

Other categories: Tecia solanivora;

De verandering in klimaat kan nieuwe fytosanitaire risico’s voor de aardappelsector opleveren, stelt Bert Waterink, sectormanager Akkerbouw bij de Nederlandse Voedsel- en Warenautoriteit (NVWA). Telers kunnen in de toekomst worden geconfronteerd met de aardappelkever, rupsen van de aardappelmot en.......

Climate change can new plant health risks posed by the potato sector

The change in climate plant-related can create new risks for the potato sector generatebenefits says Bert Waterink, sectormanager arable farming in the dutch Voedsel en Waren Autoriteit (NVWA). Sericulturists can in future be confronted with the aardappelkever, caterpillars of the aardappelmot and...

More articles...

Euphranta canadensis

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

GibberellaCircinata-PHT

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Haplaxius crudus

Texas Phoenix Palm Decline, Lethal Bronzing (TPPD) External link

Source country freshfromflorida Wednesday, April 1, 2020 4:16:00 AM CEST | info [other]

Trigger words: [HaplaxiusCrudus-PHT] Myndus crudus[1]; Haplaxius crudus[1]; Haplaxiux crudus[1];

Entities: Leon Levy[1]; David Davidson[1]; Lee Levy[1];

Other categories: Multiple Species; Colours;

Texas Phoenix Palm Decline (also referred to as lethal bronzing) Susan Halbert, Ph.D., Jodi Hansen and David Davidson; Bureau of Entomology, Nematology and Plant Pathology DPIHelpline@FreshFromFlorida.com or 1-888-397-1517 INTRODUCTION: Texas Phoenix palm decline (TPPD), also referred to as lethal bronzing (Figs....

Texas Phoenix Palm Decline (TPPD) External link

Source country freshfromflorida Monday, March 2, 2020 2:20:00 PM CET | info [other]

Trigger words: [HaplaxiusCrudus-PHT] Myndus crudus[1]; Haplaxius crudus[1]; Haplaxiux crudus[1];

Entities: Leon Levy[1]; David Davidson[1]; Lee Levy[1];

Other categories: Multiple Species; Colours;

Texas Phoenix Palm Decline (also referred to as lethal bronzing) Susan Halbert, Ph.D., Jodi Hansen and David Davidson; Bureau of Entomology, Nematology and Plant Pathology DPIHelpline@FreshFromFlorida.com or 1-888-397-1517 INTRODUCTION: Texas Phoenix palm decline (TPPD), also referred to as lethal bronzing (Figs....

More articles...

Helicoverpa zea

Tecnologías diseñadas para maximizar rindes y bajar costos External link

Source country on24 Thursday, April 2, 2020 4:00:00 PM CEST | info English text... [en] [other]

Trigger words: [HelicoverpaZea-PHT] isoca de la espiga[1]; Helicoverpa zea[1];

Other categories: Spodoptera frugiperda; Fungicides;

En un evento a campo organizado por la firma GICSA (distribuidor aliado y multiplicador de Syngenta), pudieron observarse en acción nuevas tecnologías diseñadas para maximizar rindes y bajar costos. Syngenta presentó materiales con genética propia en soja y maíz, al tiempo que se evaluaron las.......

Asian-designed technologies to maximise rindes and lower costs

In an event to camp organised by the signature GICSA (distributor ally and multiplier of Syngenta), were observed in action new technologies designed to maximise rindes and lower costs. Syngenta submitted its own genetic material with soya and maize, while assessed the....

Nuevos maíces y girasoles External link

Source country on24 Monday, March 30, 2020 4:35:00 PM CEST | info English text... [en] [other]

Trigger words: [HelicoverpaZea-PHT] helicoverpa zea[1];

Other categories: Spodoptera frugiperda; Stem rust;

Syngenta organizó dos reuniones técnicas en las ciudades de Charata (Chaco) y Avellaneda (Santa Fe), para acercar soluciones enfocadas en girasol y maíz a la zona del NEA. Participaron de las mismas más de doscientos productores y asesores generando un valioso espacio de intercambio de experiencias productivas....

New maizes and sunflower

Syngenta organised two technical meetings in the cities of Charata (Chaco) and Avellaneda (Santa Fe), to bring solutions aimed at sunflower and maize to the area of NEA. Participated in the same over 200 producers and advisers generating a valuable area of exchange of experiences productivas.

More articles...

Category for the Heterodera zeae plant health threat

Analysis of cyst and cone top morphometrics of indian populations of maize cyst nematode External link

Source country plantprotection Thursday, August 1, 2019 7:14:00 AM CEST | info [other]

Trigger words: [HeteroderaZeae-PHT] Heterodera zeae[1];

Other categories: Heterodera elachista;

Hierarchical cluster analysis based on cyst and cone top morphometric means including cyst length, cyst width, cyst length to cyst width ratio, vulval slit length, vulval bridge length, vulval bridge breadth, under bridge breadth, length of fenestra, breadth of fenestra, distance from anus to.......

More articles...

Hosta virus X

Occurrence, infectivity and molecular characterization of hosta virus X in Northeast China External link

Source country tandfonline-cjpp Friday, February 28, 2020 4:58:00 PM CET | info [other]

Trigger words: [HostaVirusX-PHT] hosta virus X[1]; Hosta virus X[1];

Other categories:

Hosta virus X (HVX) is the most economically significant virus infecting hosta ( Hosta spp.) plants worldwide, and has been reported from North America, Europe, Asia and Oceania. In May 2019, various viral-like disease symptoms were observed on hosta plants in a park in Harbin City in Northeast.......

More articles...

Liriomyza sativae

Nation: Use Big Data to guarantee food security External link

Source country kenyamoja Monday, March 9, 2020 10:59:00 PM CET | info [other]

Trigger words: [LiriomyzaSativae-PHT] tomato leaf miner[2];

Other categories: food security; Pesticides; Spodoptera frugiperda; Multiple Species; Environment;

A man scares away desert locusts in a farm in Machakos. PHOTO | FILE | NATION MEDIA GROUP In Summary. The agriculture sector is one that can benefit most by exploring the hidden treasures in Big Data analytics, now that this agro-data is available for free to all stakeholders....

Pest categorisation of Liriomyza sativae External link

Source country efsa Monday, March 9, 2020 12:02:00 PM CET | info [other]

Trigger words: [LiriomyzaSativae-PHT] Liriomyza sativae[2]; vegetable leaf miner[1];

Other categories: EFSA; European Food Safety Authority; Feed;

The EFSA Panel on Plant Health performed a pest categorisation of Liriomyza sativae (Diptera: Agromyzidae) for the EU. L. sativae (the cabbage or vegetable leaf miner; EPPO code: LIRISA) is a polyphagous pest native to the Americas which has spread to Africa, Asia and Oceania. L. sativae can have multiple overlapping generations per year....

More articles...

Longidorus diadecturus

Web report of the 12 th Meeting of the Panel on Diagnostics in Nematology (EPPO Headquarters, Paris, 2019-11-12/14) External link

Source country eppo Tuesday, January 21, 2020 4:55:00 AM CET | info [other]

Trigger words: [LongidorusDiadecturus-PHT] Longidorus diadecturus[1];

Other categories: Bursaphelenchus xylophilus; Globodera rostochiensis; Hirschmanniella spp.; Meloidogyne mali; Multiple Species;

12 th Meeting of the Panel on Diagnostics in Nematology EPPO Headquarters, Paris (FR) 2019-11-12/14 Development of EPPO diagnostic protocols. The Panel reviewed one new protocol and several protocols for which revision is in progress (see below). They also made plans for a new protocol on.......

More articles...

Meloidogyne ethiopica

Inga Zasada External link

Source country hortsci Friday, April 3, 2020 4:52:00 AM CEST | info [other]

Trigger words: [MeloidogyneEthiopica-PHT] root-knot nematode[2];

Other categories: Soil Erosion; Pesticides; Herbicides; Nitrates; Food Contact Material;

Clove oil derived from the clove plant [ Syzygium aromaticum =Eugenia caryophyllata )] is active against various soil-borne plant pathogens and therefore has potential for use as a bio-based pesticide. A clove oil formulation previously found to be toxic to the southern root-knot nematode (.......

Husein A. Ajwa External link

Source country horttech Thursday, April 2, 2020 5:13:00 AM CEST | info [other]

Trigger words: [MeloidogyneEthiopica-PHT] root-knot nematode[1];

Other categories: Chloropicrin; Pesticides; Sodium; Methyl;

Strawberry ( Fragaria ananassa Duchesne) is a high-value cash crop that benefits from preplant soil fumigation with methyl bromide (MB) and chloropicrin (CP). Methyl bromide will be banned in the U.S. and other developed countries by 2005 for most uses....

More articles...

Mycodiella laricis-leptolepidis

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Myiopardalis pardalina

Феромонные и цветные ловушки, шмелиные семьи External link

Source country vniikr Saturday, March 7, 2020 4:38:00 AM CET | info English text... [en] [other]

Азиатская хлопковая совка Spodoptera litura; Азиатская ягодная дрозофила Drosophila suzukii NEW; Азиатский усач Anoplophora glabripennis; Амбарный долгоносик Sitophilus granarius; Американская белая бабочка Hyphantria cunea; Американский коконопряд Malacosoma americanum; Большая комнатная муха Musca.......

Pheromone and tsvetnye sandies, bumble-bee family

Burmillas cotton thysania Spodoptera litura; burmillas uvaria Drosophila drosophila suzukii NEW; the asian virginea Anoplophora glabripennis; Амбарный iong nose Sitophilus granarius; american webworm Hyphantria cunea; american Malacosoma malacosoma americanum; big housefly Musca.......

тридцатый номер журнала «Карантин растений. Наука и практика» External link

Source country vniikr Saturday, March 7, 2020 4:38:00 AM CET | info English text... [en] [other]

Trigger words: [MyiopardalisPardalina-PHT] Myiopardalis pardalina[1]; Дынная муха[1];

Other categories: Xylosandrus crassiusculus; Invasive Alien Species; Massicus raddei; Globodera rostochiensis; Zaprionus indianus; Zaprionus tuberculatus; Tephritidae; Xylella fastidiosa;

PLANT HEALTH RESEARCH AND PRACTICE RUSSIAN-ENGLISH JOURNAL DECEMBER 4/30/2019IS SN 2 30 6- 97 67 КАРАНТИН РАСТЕНИЙ НАУКА И ПРАКТИКА ДЕКАБРЬ 4/30/2019 СИГНАЛЬНЫЙ ПЕРЕЧЕНЬ – 2019 ЕВРОПЕЙСКОЙ И СРЕДИЗЕМНОМОРСКОЙ ОРГАНИЗАЦИИ ПО КАРАНТИНУ И ЗАЩИТЕ РАСТЕНИЙ стр....

The magazine savely govorkov the'rzsz ambered plant-watering. Science and practice "

Plant HEALTH RESEARCH AND PRACTICE RUSSIAN-ENGLISH editorin-chief DECEMBER 4/30/2019is 2as2 2 30 6 - 97 ‎67 ambered crop-protecting science AND PRACTICE of DECEMBER 4/30/2019th 2019th alert list – the european AND mediterranean PLANT protection organization for quarantine AND p.

More articles...

Nemorimyza maculosa

Pest categorisation of Nemorimyza maculosa External link

Source country efsa Thursday, March 5, 2020 2:32:00 PM CET | info [other]

Trigger words: [NemorimyzaMaculosa-PHT] Amauromyza maculosa[1]; Nemorimyza maculosa[2];

Entities: Hans Hermann[1]; Stephen Parnell[1]; Sylvie van der Werf[1]; Claude Bragard[1]; Alan MacLeod[1];

Other categories: EFSA; European Food Safety Authority; Feed;

The EFSA Panel on Plant Health performed a pest categorisation of Nemorimyza maculosa (Malloch) (Diptera: Agromyzidae) for the European Union (EU). N. maculosa is an oligophagous pest; cultivated hosts include Chrysanthemum , lettuce and other Asteraceae although there is little evidence of recent impacts....

Brazil authorizes use of spinetoram for chrysanthemum External link

Source country agropages Wednesday, January 29, 2020 11:49:00 AM CET | info [other]

Trigger words: [NemorimyzaMaculosa-PHT] Amauromyza maculosa[1];

Other categories: Liriomyza sativae; Insecticides;

By Leonardo Gottems, Reporter for Agropages. Brazil has approved for use those products already registered in the country based upon the active ingredient spinetoram, in a concentration of 250g/Kg. The decision comes from the Ministry of Agriculture, Livestock and Supply (Mapa), and was published in.......

More articles...

Neoceratitis cyanescens

Serge Quilici External link

Source country wiley-EPPOb Wednesday, May 29, 2019 6:37:00 AM CEST | info [other]

Trigger words: [NeoceratitisCyanescens-PHT] Neoceratitis cyanescens[1];

Other categories: Bactrocera zonata; Bactrocera tsuneonis; Invasive Alien Species; Tephritidae; BactroceraCucurbitae-PHT; Multiple Species;

Understanding the strength and modes of interspecific interactions between introduced and resident species (native or previously introduced) is necessary to predict invasion success. We evaluated different mechanisms of interspecific competition among four species of polyphagous fruit flies.......

More articles...

Peach mosaic virus

'Over dierziekten, het coronavirus en China' External link

Source country boerderij Thursday, March 5, 2020 6:21:00 AM CET | info English text... [en] [other]

Trigger words: [PeachMosaicVirus-PHT] PCMV[1];

Other categories: Cytomegalovirus; Respiratory Syndrome; Coronavirus Infection; Other Zoonoses;

Ik voer regelmatig een TBS-onderzoek op varkensbedrijven uit, meestal bij de gespeende biggen. Nee, dit gaat niet over een terbeschikkingstelling van varkens, de afkorting betekent tracheobronchiaal-swab . Een mooie naam voor een vrij eenvoudig onderzoek: het houdt in dat er wat slijm uit de diepere luchtwegen genomen wordt via een zachte katheter....

'On animal diseases, the coronavirus and China, "

I regularly dutiesimports TBS-onderzoek from a vaccine, mostly in the weaned piglets. No, this is not about a posting of pigs, the abbreviation means tracheobronchiaal-swab. A nice name for a relatively simple research: it means that some stem from the deeper air-passages shall be taken through a soft catheter-related.

Marijuana giant Acreage concedes Mass. contracts are ‘inoperable’ External link

Source country bostonglobe Sunday, February 9, 2020 4:51:00 AM CET | info [other]

Trigger words: [PeachMosaicVirus-PHT] PCMV[3];

Entities: George Allen[1]; Bill Weld[1]; John Boehner[1];

Other categories:

Under state law, a single company may own or control only three marijuana stores. With Acreage already pursuing licenses in Worcester and Shrewsbury under its directly owned Botanist brand, investigators wrote in their report, the New York-based firm would eventually exceed the three-store cap if.......

More articles...

Peach rosette phytoplasma

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Peach yellows phytoplasma

A boy fights kidney cancer with the help of his family External link

Source country 680news Saturday, January 12, 2019 4:24:00 PM CET | info [other]

Trigger words: [PeachYellowsPhytoplasma-PHT] disease[1]; little peach[1];

Entities: Elijah Thomas[1]; Brian Kavanagh[1];

Other categories: Medical Devices Adverse Effects;

Quotes... Quotes in this article

Brian Kavanagh says: “There must be follow-up long term, for a return of the cancer or delayed impacts of any of the therapies used to fight it, (but) we do have every hope and expectation that he will reach teenage-hood, adulthood and beyond,”

COLORADO SPRINGS, Colo. — They coo soothing words through gritted teeth, over the coughing and the writhing and the desperate cries of “Ow!” and “Please stop!” from their 4-year-old son on the hospital bed. Joseph and Amanda Salmoiraghi know they’re doing what must be done. This has been their life for the past 1 1/2 years....

More articles...

Pepino mosaic virus

Interfamily transfer of Arabidopsis lectin-mediated antiviral gene confers resistance to pepino mosaic virus in tomato External link

Source country springer-jgpp Wednesday, April 1, 2020 8:35:00 PM CEST | info [other]

Trigger words: [PepinoMosaicVirus-PHT] pepino mosaic virus[2]; PepMV[2];

Other categories: GM Animals;

In plant antiviral breeding, R genes encoding nucleotide-binding site and leucine-rich repeat (NB-LRR) proteins serve as major genetic resources to introduce antiviral traits to crop cultivars. However, interfamily transfer—heterologous expression in a plant belonging to a taxonomically different.......

Semi infetti bloccati al porto di Livorno: provenivano dalla Cina External link

Source country repubblica Friday, March 27, 2020 7:47:00 PM CET | info English text... [en] [other]

Trigger words: [PepinoMosaicVirus-PHT] PepMV[1];

Entities: Fabrizio Filippi[1]; Marco Remaschi[1];

Other categories: Coronavirus Infection; Pathogen-of-war; Potato spindle tuber viroid;

Un carico “infetto”, che secondo gli esperti avrebbero potuto provocare danni gravissimi all’agricoltura locale. L’hanno scoperto nei gironi scorsi i tecnici del servizio fitosanitario della regione Toscana, durante una serie di controlli nel porto di Livorno....

Seeds infected blocked in the port of Livourne: came from china

A cargo “infected”, which analysts say could cause severe damage to agriculture. It was discovered in recent days the experts from servizio fitosanitario della regione Toscana, during a series of checks at the port of Livorno.

More articles...

Coniferiporia weirii

The Christmas Tree: Traditions, Production, and Disease External link

Source country apsnet Wednesday, July 11, 2018 4:28:00 AM CEST | info [other]

Trigger words: [PhellinusWeirii-PHT] root rot of conifers[1];

Entities: Smith Jr[1]; Paul Kirk[1];

Other categories: Phymatotrichopsis omnivora; New Plant Pests; Sirococcus tsugae;

For growers to minimize the impact of interior needle blight on the production of noble fir in the PNW, additional studies are needed relating to the etiology and epidemiology of this disease. Studies are also needed to identify alternatives to chlorothalonil-based products that are effective in controlling this disease....

More articles...

Phymatotrichopsis omnivora

Aislamiento y selección de hongos de suelo solubilizadores de fósforo nativos del estado de Coahuila, México External link

Source country abm Wednesday, March 4, 2020 9:43:00 AM CET | info English text... [en] [other]

Trigger words: [PhymatotrichopsisOmnivora-PHT] Phymatotrichum omnivorum[1];

Entities: Borja Martínez[1]; Hernandez Rodriguez[1]; Paul V[1]; Silva Filho[1];

Other categories: GMOs in Environment; Nitrogen; GMOs in food & feed;

Referencias Asea, P. E. A., R. M. N. Kucey y J. W. B. Stewart. 1988. Inorganic phosphate solubilization by two Penicillium species in solution culture and soil. Soil Biology and Biochemistry 20(4): 459-464. DOI: https://doi.org/10.1016/0038-0717(88)90058-2. Ashok, V. G., S. S. Sabina y G. D. Preeti. 2012....

Isolation and selection of champignons resin-based phosphorus solubilizer natives of the state of Coahuila, mexico

References Asea, P. E. A., R. M. N. Kucey and J. W. B. Stewart. 1988. Inorganic phosphate solubilization by two pénicillium species in solution culture and Soil. Soil Biology and Biochemistry 20 (4): 459 - 464. Doi: https://DOI. org/10.1016/0038 - 0717 (88) 90058 - 2. Late Ashok, E. G., S. S. Sabina and G. D. Preeti. 2012.

Sperry: Rose rosette virus has been especially damaging External link

Source country wacotrib Saturday, February 1, 2020 6:06:00 AM CET | info [other]

Trigger words: [PhymatotrichopsisOmnivora-PHT] cotton root rot[2];

Other categories:

However, almost all of the questions I’ve gotten over the past 10 years relative to rose diseases have been about rose rosette virus (RRV). It is spread by a wind-blown microscopic mite. Contrary to what some may try to get you to believe, there is no prevention nor any cure....

More articles...

Pityophthorus juglandis

Host selection behavior mediated by differential landing rates of the walnut twig beetle, Pityophthorus juglandis, and associated subcortical insect s External link

Source country wiley-eeapplicata Saturday, March 21, 2020 11:22:00 AM CET | info [other]

Trigger words: [PityophthorusJuglandis-PHT] Pityophthorus juglandis[2]; walnut twig beetle[2];

Other categories: Geosmithia morbida; Multiple Species; Food Contact Material;

The walnut twig beetle, Pityophthorus juglandis Blackman (Coleoptera: Scolytidae), vectors a phytopathogenic fungus, Geosmithia morbida Kolařík et al. (Hypocreales), which causes thousand cankers disease (TCD) in walnut ( Juglans sp.) and wingnut ( Pterocarya sp., both Juglandaceae) trees....

Northeast states receive spotted lanternfly funding External link

Source country farmindustrynews Tuesday, March 10, 2020 11:04:00 AM CET | info [other]

Trigger words: [PityophthorusJuglandis-PHT] Walnut twig beetle[2];

Entities: Greg Ibach[1];

Other categories: Agrilus planipennis; Geosmithia morbida; Invasive Alien Species; Globodera pallida; Heterodera elachista; Globodera rostochiensis; Phytophthora ramorum; Halyomorpha halys; Anoplophora glabripennis; New Plant Pests; Popillia japonica;

Quotes... Quotes in this article

Greg Ibach says: “Pennsylvania is a critical partner in protecting U.S. agriculture,”

Millions of dollars in federal grants are being awarded to states for pest and plant health mitigation, including hundreds of thousands toward spotted lanternfly research and prevention. Maryland is getting $1.2 million in USDA plant protection funding, including $435,434 for spotted lanternfly.......

More articles...

Polygraphus proximus

На «Столбах» в Красноярске закрыли опасную тропу External link

Source country Newslab Tuesday, March 31, 2020 8:46:00 AM CEST | info English text... [en] [other]

Trigger words: [PolygraphusProximus-PHT] Polygraphus proximus Blandford[1]; Polygraphus proximus[1];

Other categories:

В красноярском нацпарке для посетителей перекрывают проход по участку туристического маршрута от Первого до Третьего Столба. Там стало небезопасно. На данном участке массово усыхает пихты из-за уничтожения их вредителем ( полиграфом уссурийским). С ухостойные деревья могут в любой момент упасть на гуляющих туристов....

At the'rzsz stollbach” in krasnoyarsk cancei dangerous kamzik

In the national park krasnoyarskom tuples overlap проход tourist-style station on the route from the first to the third pillar. There was not safe. At this station massively shrivels of silver owing to the destruction of their spoiler (poly-l-lactic duketown уссурийским). With ухостойные trees can at any moment to fall on the latter visit tourists.

Решением суда лесоперерабатывающей организации в Красноярском крае назначено наказание в виде административного приостановления деятельности External link

Source country fsvps Friday, November 22, 2019 8:59:00 AM CET | info English text... [en] [other]

Trigger words: [PolygraphusProximus-PHT] Polygraphus proximus Blandford[1]; Polygraphus proximus[1];

Other categories:

В ноябре 2019 года Управлением Россельхознадзора по Красноярскому краю при проведении проверки лесоперерабатывающего предприятия ООО «Вудэксп ИСТ» в Сухобузимском районе выявлены нарушения законодательства Российской Федерации в области обеспечения карантина растений....

The decision of the court of forest re-compressing rabash tuva under or organization in krasnoyarskom krae expectedto punishment in the form of admini

In November 2019 100pcs office of krasnoyarsk to the verification of the proceeds of a forest re-compressing rabash tuva enterprise ООО the'rzsz Вудэксп cogi” in sukhobusimo area identified violations of the legislation of the Russian federation in the field of plant quarantine.

More articles...

Pseudomonas syringae pv. actinidiae

Flood inoculation of seedlings on culture medium to study interactions between Pseudomonas syringae pv. actinidiae and kiwifruit External link

Source country springer-jgpp Friday, March 27, 2020 4:07:00 PM CET | info [other]

Trigger words: [PseudomonasSyringaePvActinidiae-PHT] Pseudomonas syringae pv. actinidiae[1];

Other categories:

Bacterial inoculation. A flood-inoculation method that we developed previously (Ishiga et al. ) to infect Arabidopsis seedlings with P. syringae pathogens was modified to develop a kiwifruit seedling inoculation method conducive to observing disease symptoms. Briefly, 40 ml of bacterial suspension (OD 600 of 0....

Actualización de plagas cuarentenarias presentes en Chile External link

Source country portalfruticola Tuesday, March 17, 2020 10:43:00 AM CET | info English text... [en] [other]

Trigger words: [PseudomonasSyringaePvActinidiae-PHT] cancro bacteriano del kiwi[1]; Bacteriosis del kiwi[1]; Pseudomonas syringae pv. actinidiae[1];

Other categories: Xylella fastidiosa; Aquatic Animals; Multiple Species; Colours; Food Contact Material; Natural Carotenoid Dye;

El contenido de este artículo de nuestra sección de Agrotecnia fue elaborado por www.sag.gob.cl , y fue revisado y reeditado por Portalfruticola Plagas cuarentenarias presentes en Chile. El control oficial de plagas involucra todas las acciones que se ejercen para controlar, suprimir o erradicar.......

Updating of pests cuarentenarias present in Chile

The content of this article in our section of Agrotecnia was prepared by www. sag. govt. cl, and was reviewed and reprinted by Portalfruticola pests cuarentenarias present in Chile. The official control of pests involves all actions that are exercised to control, eliminate or eradicate....

More articles...

Category for the Pseudomonas syringae pv. aesculi plant health threat

The work will take place on Sunday External link

Source country stokesentinel Friday, March 20, 2020 11:30:00 PM CET | info [other]

Trigger words: [PseudomonasSyringaePvAesculi-PHT] Bleeding Canker[1];

Other categories:

A borough council spokesman said: "The Lime and Beech trees are at the side of the town’s Corporation Street and an inspection found they were in poor condition and could pose a danger to pedestrians and motorists. "The work will be carried out from 8am on Sunday (22 March) and the road will be.......

13:47 Zo’n 28.000 boompjes tellen, dat wordt nog een hele klus External link

Source country brabantsdagblad Sunday, March 8, 2020 1:54:00 PM CET | info English text... [en] [other]

Trigger words: [PseudomonasSyringaePvAesculi-PHT] kastanjebloedingsziekte[1];

Other categories:

Zo’n 28.000 boompjes tellen, dat wordt nog een hele klus. VLIJMEN - Ze denken dat het er zo’n 28.000 zijn. Om het zeker te weten stuurt Heusden bomentellers op pad. Die ook gelijk kijken hoe gezond de bomen nog zijn en of ze de veiligheid in gevaar brengen....

13:47 imneizil 28 000 boompjes head-counts, that is still a whole klus

Some 28,000 boompjes head-counts, that is quite a task. Vlijmen - they believe that it has some 28,000. In order to know for sure it sends Heusden bomentellers on path. That is also right to look at how healthy the trees and whether they are still endanger safety.

More articles...

Pseudopityophthorus minutissimus

В ФГБУ «ВНИИКР» состоялось заседание Ученого совета External link

Source country fsvps Wednesday, June 5, 2019 1:43:00 PM CEST | info English text... [en] [other]

Trigger words: [PseudopityophthorusMinutissimus-PHT] Pseudopityophthorus minutissimus[1];

Other categories: Epitrix spp.;

В первых числах июня 2019 года в ФГБУ «ВНИИКР» состоялось очередное открытое заседание Ученого совета учреждения. В ходе заседания были рассмотрены и утверждены научно-исследовательские работы по темам: 1. Анализ фитосанитарного риска злаковой цистообразующей нематоды Heterodera avena Wollenweber для территории Российской Федерации; 2....

The meeting was held "the'rzsz yegoryevsk ВНИИКР know—maybe

In the first days of June 2019 in the'rzsz yegoryevsk ВНИИКР” anotherseason learn'd held an open meeting of the council of the institution. During the meeting, were reviewed and approved by the scientific research work on the topics of: 1. Analysis of the phytosanitary risk злаковой цистообразующей nematoda Heterodera avena wollen weber for the territory of the russian federation; 2.

More articles...

Pseudopityophthorus pruinosus

Pest categorisation of Pseudopityophthorus minutissimus and P. pruinosus External link

Source country efsa Friday, January 11, 2019 3:49:00 PM CET | info [other]

Trigger words: [PseudopityophthorusPruinosus-PHT] Pseudopityophthorus pruinosus[1];

Entities: Hans Hermann[1]; Francesco Di[1]; Sylvie van der Werf[1];

Other categories: EFSA; Pseudopityophthorus minutissimus; Ceratocystis fagacearum; European Food Safety Authority;

The Panel on Plant Health performed a pest categorisation of Pseudopityophthorus minutissimus and Pseudopityophthorus pruinosus , two well‐defined insect species in the family Curculionidae, subfamily Scolytinae (Insecta: Coleoptera). They can be identified using taxonomic keys. P. minutissimus is present in parts of Canada and the USA, and P....

More articles...

Rhagoletis completa

Calypso SC 480 External link

Source country agroklub Sunday, March 29, 2020 2:58:00 PM CEST | info English text... [en] [other]

Trigger words: [RhagoletisCompleta-PHT] Rhagoletis completa[1];

Other categories: Tephritidae; Thrips palmi;

. Calypso sa svojim spektrom djelovanja postavlja nove temelje suvremene zatite bilje. Na voćkama i povrću brzo i učinkovito suzbija sve vrste ui. Izvanredno se brzo upija u biljno tkivo, čime je onemogućeno ispiranje kiom, postojan je i na djelovanje sunčeve svjetlosti....

Calypso SC 480

. Calypso with their range of operations sets new foundation of contemporary issues herbs. The fruit trees and vegetables quickly and efficiently fights all kinds of Trenton. Extraordinary soaks up the plant tissue, which is disabled, irrigation Kia, he's solid, and the action of sunlight.

Web report of the 6 th Meeting of the EPPO Panel on Diagnostics in Entomology (Paris, 2020-03-03/05) External link

Source country eppo Friday, March 13, 2020 4:59:00 AM CET | info [other]

6 th Meeting of the EPPO Panel on Diagnostics in Entomology Paris, 2020-03-03/05. The 6 th meeting of the EPPO Panel on Diagnostics in Entomology took place in the Headquarters of the European and Mediterranean Plant Protection Organization in Paris. The EPPO Secretariat was pleased to welcome new.......

More articles...

Rhagoletis pomonella

Suzette P. Galinato External link

Source country horttech Thursday, April 2, 2020 5:13:00 AM CEST | info [other]

Trigger words: [RhagoletisPomonella-PHT] Apple maggot[2]; Rhagoletis pomonella[1];

Other categories: Tephritidae; New Plant Pests; Multiple Species;

Lettuce ( Lactuca sativa ) and tomato ( Solanum lycopersicum ) are popular fresh market vegetable crops. In western Washington, there is interest in growing them in high tunnel production systems because of the region’s mild, coastal climate. The objectives of this study were to contrast the.......

Advanced Genetic Analysis of Invasive Arthropods External link

Source country oxforduniversitypress-amt Wednesday, April 1, 2020 6:21:00 PM CEST | info [other]

Trigger words: [RhagoletisPomonella-PHT] Rhagoletis pomonella[1];

Entities: Gary Peterson[1]; Scott Armstrong[1];

Other categories: Tephritidae; New Plant Pests; Invasive Alien Species; Multiple Species; Food Contact Material; Tickeners;

We propose an applied empirical framework for invasion science that channels collaborative research toward the production of tools for direct uptake in invasive species management. We illustrate the framework with example projects from the BioSAFE initiative, a highly-collaborative research effort.......

More articles...

Septoria malagutii

Pest categorisation of Septoria malagutii External link

Source country efsa Wednesday, December 12, 2018 4:00:00 PM CET | info [other]

Trigger words: [SeptoriaMalagutii-PHT] Septoria lycopersici var. malagutii[1]; Septoria malagutii[2]; annular leaf spot of potato[1];

Entities: Hans Hermann[1]; Francesco Di[1]; Sylvie van der Werf[1];

Other categories: EFSA; Stagonosporopsis andigena; European Food Safety Authority;

The Panel on Plant Health performed a pest categorisation of Septoria malagutii , the causal agent of annular leaf spot of potato, for the EU. The pest is a well‐defined fungal species and reliable methods exist for its detection and identification. S. malagutii is present in Bolivia, Ecuador, Peru and Venezuela....

More articles...

Squash leaf curl virus

Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil External link

Source country springer-av Saturday, January 11, 2020 10:35:00 AM CET | info [other]

Trigger words: [SquashLeafCurlVirus-PHT] squash leaf curl virus[1];

Other categories: Bean golden mosaic virus; Tomato mottle virus; Bemisia Tabaci;

Fig. 1. Bayesian phylogenetic consensus trees constructed using the complete nucleotide sequences of the DNA-A (A) and DNA-B (B) components of sida yellow golden mosaic virus (SiYGMV), a new bipartite begomovirus infecting Sida sp. in the state of Piaui in Northeastern Brazil, and the most closely related begomoviruses....

New host records for cotton leaf curl Gezira virus : capsicum and melon in Egypt External link

Source country springer-apdn Friday, January 3, 2020 3:30:00 AM CET | info [other]

Trigger words: [SquashLeafCurlVirus-PHT] squash leaf curl virus[1];

Other categories: Bemisia Tabaci;

DNA-A amplicons were obtained from four samples which were sequenced and analysed by BLASTN (National Centre for Biotechnology Information) to give putative virus identifications. Amplicons from two of the samples were identical to CLCuGeV and the amplicons from the remaining two sample were.......

More articles...

Stagonosporopsis andigena

Web report of the 60th Meeting of the Panel on Phytosanitary Measures (Braunschweig, DE, 2019-10-22/24) External link

Source country eppo Wednesday, December 11, 2019 5:13:00 AM CET | info [other]

Trigger words: [StagonosporopsisAndigena-PHT] Stagonosporopsis andigena[1]; Phoma andina[2];

Entities: Julius Kuhn[1]; Alert List[2];

Other categories: Anoplophora glabripennis; in vitro diagnostic devices; Meloidogyne ethiopica; EFSA;

European and Mediterranean Plant Protection Organization Organisation Européenne et Méditerranéenne pour la Protection des Plantes. 60 th Meeting of the Panel on Phytosanitary Measures Braunschweig, DE, 2019-10-22/24. The Panel met in Braunschweig (DE) on 2019-10-22/24 at the kind invitation of the Julius Kühn Institute (JKI)....

More articles...

Category for the Thaumastocoris peregrinus plant health threat

Is Isaria fumosorosea selective to Trichogramma pretiosum (Hymenoptera: Trichogrammatidae)? Michele POTRICH, Gabriela LIBARDONI, Luis F.A. ALVES, Vand External link

Source country eje Thursday, March 5, 2020 1:48:00 PM CET | info [other]

Trigger words: [ThaumastocorisPeregrinus-PHT] Thaumastocoris peregrinus[1];

Entities: Luiz de Queiroz[8];

Other categories: Helicoverpa zea; Bemisia Tabaci; Pesticides; Liriomyza sativae; Hajj; Apidae; Multiple Species; Bacillus; Bacteria;

Alves S.B. 1998: Fungos entomopatogênicos. In Alves S.B. (ed.): Controle Microbiano de Insetos. 2nd ed. Fundação de Estudos Agrários Luiz de Queiroz, Piracicaba, pp. 289-381. Alves S.B. & Pereira R.M. 1998: Distúrbios fisiológicos provocados por entomopatógenos. In Alves S.B. (ed.): Controle Microbiano de Insetos....

Detección de Thaumastocoris peregrinus en Región Metropolitana. External link

Source country ippc Wednesday, February 12, 2020 6:06:00 AM CET | info English text... [en] [other]

Trigger words: [ThaumastocorisPeregrinus-PHT] Thaumastocoris peregrinus[3];

Other categories:

Publication Date: Mon, 18 Oct 2010, 02:00; Last Updated: Oct. 17, 2010, 11:01 a.m. Report Number: CHL-23/2; Country: Chile; Pest Id: Thaumastocoris peregrinus - (THMCPE) Report Status: Final; Hosts: Eucalyptus spp. Pest Status: Present: subject to official control; Geographical Distribution: Ãrea bajo control oficial en la Región Metropolitana....

Detection of Thaumastocoris peregrinus in metropolitan region.

Publication Date: Mon, 18 Oct 2010 02:00 Last Updated: Oct. 17,2010,11:01 a. m. Report Number: CHL - 23/2; Country: Chile; Pest Id: Thaumastocoris peregrinus - (THMCPE) Report Status: Final; Hosts: Eucalyptus spp. Pest Status: Present: subject to official control; Geographical Distribution: Ãrea under official control in the metropolitan Región.

More articles...

Tomato apical stunt viroid

USDA/APHIS - Tomato and Pepper Seeds Federal Order FAQ's External link

Source country seedquest Friday, September 27, 2019 6:21:00 PM CEST | info [other]

Trigger words: [TomatoApicalStuntViroid-PHT] Tomato apical stunt viroid[5];

Other categories: Potato spindle tuber viroid;

Q What will happen if the tomato and/or pepper seed shipments do not have a Phytosanitary Certificate with the required additional declaration statement, as required by the Federal Order effective September 8, 2019? A . Shipments of tomato or pepper seeds without the required additional declaration will be refused entry into the United States....

More articles...

Tomato mottle virus

Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil External link

Source country springer-av Saturday, January 11, 2020 10:35:00 AM CET | info [other]

Trigger words: [TomatoMottleVirus-PHT] tomato mottle virus[1];

Other categories: Squash leaf curl virus; Bean golden mosaic virus; Bemisia Tabaci;

Fig. 1. Bayesian phylogenetic consensus trees constructed using the complete nucleotide sequences of the DNA-A (A) and DNA-B (B) components of sida yellow golden mosaic virus (SiYGMV), a new bipartite begomovirus infecting Sida sp. in the state of Piaui in Northeastern Brazil, and the most closely related begomoviruses....

Download PDF (2477KB) External link

Source country springer-onlineFirst Wednesday, January 1, 2020 4:58:00 PM CET | info [other]

Trigger words: [TomatoMottleVirus-PHT] Tomato mottle virus[1]; Tomato Mottle virus[1];

Entities: Shahid Mansoor[1]; Thermo Fisher[3]; Khadim Hussain[1];

Other categories: GMOs in food & feed 2; Tomato leaf curl New Delhi virus; New Plant Pests; Bemisia Tabaci;

ORIGINAL PAPER Association of cotton leaf curl Multan betasatellite and Ageratum conyzoides symptomless alphasatellite with tomato leaf curl New Delhi virus in Luffa cylindrica in Pakistan Ifrah Anwar1,2 & Hanan Arif Bukhari1,2 & Nazia Nahid2 & Kamran Rashid2 & Imran Amin1 & Shabnum Shaheen3 &.......

More articles...

Xiphinema californicum

There are no recent articles on this subject in the chosen language. If this page has been recently added to the NewsBrief then it may take a short time to display new stories.

More articles...

Xylosandrus crassiusculus

Asian Ambrosia Beetle | opens in a new window External link

Source country freshfromflorida Wednesday, April 1, 2020 4:16:00 AM CEST | info [other]

Trigger words: [XylosandrusCrassiusculus-PHT] Asian Ambrosia Beetle[1]; Xylosandrus crassiusculus[1];

Entities: Philippine Islands[1];

Other categories:

Another Asian Ambrosia Bettle Established in Florida (Coleoptera: Curculionidae: Scolytinae: Xyleborini) Katherine E. Okins, Katherines.Okins@FreshFromFlorida.com, Cooperative Agricultural Pest Survey, Florida Department of Agriculture & Consumer Services, Division of Plant Industry Michael C. Thomas, Micahel....

Attraction of Invasive Ambrosia Beetles (Coleoptera: Curculionidae: Scolytinae) to Ethanol-Treated Tree Bolts External link

Source country bioone Monday, March 30, 2020 2:21:00 PM CEST | info [other]

Trigger words: [XylosandrusCrassiusculus-PHT] Xylosandrus crassiusculus[1];

Other categories: Pesticides;

Ethanol-treated bolts (tree stem sections) have potential as monitoring and pesticide screening tools for ambrosia beetles (Coleoptera: Curculionidae: Scolytinae). Bolts were infused with ethanol by immersing them for at least 24 h. Attacks on ethanol-treated bolts by Xylosandrus species were compared with captures in ethanol-baited traps....

More articles...

Tools

Load latest edition

Friday, April 3, 2020

6:47:00 AM CEST

Language Selection

For any category/filter, users can choose:

  1. the language of the categorized news items (e.g. fr and de to display only those news items in French and German)
  2. the language of the user interface (e.g. it for Italian)

In Top Stories, the user can display the largest clusters of news items for one language only (e.g. en shows all clusters in English)

Country Selection

Users can choose:

  1. country mentioned in the news item (articles about a country)
  2. country in which the news item was published (articles from a country)

Languages Collapse menu...Expand menu...Open help...

Select your languages

ar
az
be
bg
bs
ca
cs
da
de
el
en
eo
es
et
fa
fi
fr
ga
gl
ha
he
hi
hr
hu
hy
id
is
it
ja
ka
km
ko
ku
ky
lb
lo
lt
lv
mk
ml
mn
ms
mt
nl
no
pap
pl
ps
pt
ro
ru
se
si
sk
sl
sq
sr
sv
sw
ta
th
tr
uk
ur
vi
zh
all
Show additional languagesHide additional languages

Interface: